ID: 1176384688

View in Genome Browser
Species Human (GRCh38)
Location 21:6133490-6133512
Sequence GAACTGGCTGGCTCCGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176384688_1176384699 24 Left 1176384688 21:6133490-6133512 CCTGCACCGGAGCCAGCCAGTTC No data
Right 1176384699 21:6133537-6133559 GCGTGACGTCTGGCACCTGGCGG No data
1176384688_1176384695 14 Left 1176384688 21:6133490-6133512 CCTGCACCGGAGCCAGCCAGTTC No data
Right 1176384695 21:6133527-6133549 GCCTTGCCACGCGTGACGTCTGG No data
1176384688_1176384698 21 Left 1176384688 21:6133490-6133512 CCTGCACCGGAGCCAGCCAGTTC No data
Right 1176384698 21:6133534-6133556 CACGCGTGACGTCTGGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176384688 Original CRISPR GAACTGGCTGGCTCCGGTGC AGG (reversed) Intergenic