ID: 1176384690

View in Genome Browser
Species Human (GRCh38)
Location 21:6133496-6133518
Sequence CAGCCGGAACTGGCTGGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176384690_1176384698 15 Left 1176384690 21:6133496-6133518 CCGGAGCCAGCCAGTTCCGGCTG No data
Right 1176384698 21:6133534-6133556 CACGCGTGACGTCTGGCACCTGG 0: 2
1: 0
2: 0
3: 2
4: 58
1176384690_1176384695 8 Left 1176384690 21:6133496-6133518 CCGGAGCCAGCCAGTTCCGGCTG No data
Right 1176384695 21:6133527-6133549 GCCTTGCCACGCGTGACGTCTGG No data
1176384690_1176384699 18 Left 1176384690 21:6133496-6133518 CCGGAGCCAGCCAGTTCCGGCTG No data
Right 1176384699 21:6133537-6133559 GCGTGACGTCTGGCACCTGGCGG 0: 2
1: 0
2: 0
3: 3
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176384690 Original CRISPR CAGCCGGAACTGGCTGGCTC CGG (reversed) Intergenic