ID: 1176384692

View in Genome Browser
Species Human (GRCh38)
Location 21:6133502-6133524
Sequence ATCCTACAGCCGGAACTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176384692_1176384695 2 Left 1176384692 21:6133502-6133524 CCAGCCAGTTCCGGCTGTAGGAT No data
Right 1176384695 21:6133527-6133549 GCCTTGCCACGCGTGACGTCTGG No data
1176384692_1176384698 9 Left 1176384692 21:6133502-6133524 CCAGCCAGTTCCGGCTGTAGGAT No data
Right 1176384698 21:6133534-6133556 CACGCGTGACGTCTGGCACCTGG No data
1176384692_1176384699 12 Left 1176384692 21:6133502-6133524 CCAGCCAGTTCCGGCTGTAGGAT No data
Right 1176384699 21:6133537-6133559 GCGTGACGTCTGGCACCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176384692 Original CRISPR ATCCTACAGCCGGAACTGGC TGG (reversed) Intergenic