ID: 1176384692 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:6133502-6133524 |
| Sequence | ATCCTACAGCCGGAACTGGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1176384692_1176384699 | 12 | Left | 1176384692 | 21:6133502-6133524 | CCAGCCAGTTCCGGCTGTAGGAT | No data | ||
| Right | 1176384699 | 21:6133537-6133559 | GCGTGACGTCTGGCACCTGGCGG | 0: 2 1: 0 2: 0 3: 3 4: 76 |
||||
| 1176384692_1176384698 | 9 | Left | 1176384692 | 21:6133502-6133524 | CCAGCCAGTTCCGGCTGTAGGAT | No data | ||
| Right | 1176384698 | 21:6133534-6133556 | CACGCGTGACGTCTGGCACCTGG | 0: 2 1: 0 2: 0 3: 2 4: 58 |
||||
| 1176384692_1176384695 | 2 | Left | 1176384692 | 21:6133502-6133524 | CCAGCCAGTTCCGGCTGTAGGAT | No data | ||
| Right | 1176384695 | 21:6133527-6133549 | GCCTTGCCACGCGTGACGTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1176384692 | Original CRISPR | ATCCTACAGCCGGAACTGGC TGG (reversed) | Intergenic | ||