ID: 1176384693

View in Genome Browser
Species Human (GRCh38)
Location 21:6133506-6133528
Sequence GCAAATCCTACAGCCGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176384693_1176384695 -2 Left 1176384693 21:6133506-6133528 CCAGTTCCGGCTGTAGGATTTGC No data
Right 1176384695 21:6133527-6133549 GCCTTGCCACGCGTGACGTCTGG No data
1176384693_1176384699 8 Left 1176384693 21:6133506-6133528 CCAGTTCCGGCTGTAGGATTTGC No data
Right 1176384699 21:6133537-6133559 GCGTGACGTCTGGCACCTGGCGG No data
1176384693_1176384698 5 Left 1176384693 21:6133506-6133528 CCAGTTCCGGCTGTAGGATTTGC No data
Right 1176384698 21:6133534-6133556 CACGCGTGACGTCTGGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176384693 Original CRISPR GCAAATCCTACAGCCGGAAC TGG (reversed) Intergenic