ID: 1176384694 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:6133512-6133534 |
| Sequence | GGCAAGGCAAATCCTACAGC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1176384694_1176384699 | 2 | Left | 1176384694 | 21:6133512-6133534 | CCGGCTGTAGGATTTGCCTTGCC | No data | ||
| Right | 1176384699 | 21:6133537-6133559 | GCGTGACGTCTGGCACCTGGCGG | No data | ||||
| 1176384694_1176384695 | -8 | Left | 1176384694 | 21:6133512-6133534 | CCGGCTGTAGGATTTGCCTTGCC | No data | ||
| Right | 1176384695 | 21:6133527-6133549 | GCCTTGCCACGCGTGACGTCTGG | No data | ||||
| 1176384694_1176384698 | -1 | Left | 1176384694 | 21:6133512-6133534 | CCGGCTGTAGGATTTGCCTTGCC | No data | ||
| Right | 1176384698 | 21:6133534-6133556 | CACGCGTGACGTCTGGCACCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1176384694 | Original CRISPR | GGCAAGGCAAATCCTACAGC CGG (reversed) | Intergenic | ||