ID: 1176384698

View in Genome Browser
Species Human (GRCh38)
Location 21:6133534-6133556
Sequence CACGCGTGACGTCTGGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176384687_1176384698 26 Left 1176384687 21:6133485-6133507 CCAAGCCTGCACCGGAGCCAGCC No data
Right 1176384698 21:6133534-6133556 CACGCGTGACGTCTGGCACCTGG No data
1176384688_1176384698 21 Left 1176384688 21:6133490-6133512 CCTGCACCGGAGCCAGCCAGTTC No data
Right 1176384698 21:6133534-6133556 CACGCGTGACGTCTGGCACCTGG No data
1176384690_1176384698 15 Left 1176384690 21:6133496-6133518 CCGGAGCCAGCCAGTTCCGGCTG No data
Right 1176384698 21:6133534-6133556 CACGCGTGACGTCTGGCACCTGG No data
1176384693_1176384698 5 Left 1176384693 21:6133506-6133528 CCAGTTCCGGCTGTAGGATTTGC No data
Right 1176384698 21:6133534-6133556 CACGCGTGACGTCTGGCACCTGG No data
1176384686_1176384698 27 Left 1176384686 21:6133484-6133506 CCCAAGCCTGCACCGGAGCCAGC No data
Right 1176384698 21:6133534-6133556 CACGCGTGACGTCTGGCACCTGG No data
1176384692_1176384698 9 Left 1176384692 21:6133502-6133524 CCAGCCAGTTCCGGCTGTAGGAT No data
Right 1176384698 21:6133534-6133556 CACGCGTGACGTCTGGCACCTGG No data
1176384694_1176384698 -1 Left 1176384694 21:6133512-6133534 CCGGCTGTAGGATTTGCCTTGCC No data
Right 1176384698 21:6133534-6133556 CACGCGTGACGTCTGGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176384698 Original CRISPR CACGCGTGACGTCTGGCACC TGG Intergenic