ID: 1176384791

View in Genome Browser
Species Human (GRCh38)
Location 21:6133959-6133981
Sequence CCAACTGTCCAGAGGGCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176384781_1176384791 19 Left 1176384781 21:6133917-6133939 CCATAGAGCAAGTAGGAGAAGGA No data
Right 1176384791 21:6133959-6133981 CCAACTGTCCAGAGGGCATAGGG No data
1176384778_1176384791 21 Left 1176384778 21:6133915-6133937 CCCCATAGAGCAAGTAGGAGAAG No data
Right 1176384791 21:6133959-6133981 CCAACTGTCCAGAGGGCATAGGG No data
1176384779_1176384791 20 Left 1176384779 21:6133916-6133938 CCCATAGAGCAAGTAGGAGAAGG No data
Right 1176384791 21:6133959-6133981 CCAACTGTCCAGAGGGCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176384791 Original CRISPR CCAACTGTCCAGAGGGCATA GGG Intergenic
No off target data available for this crispr