ID: 1176386486

View in Genome Browser
Species Human (GRCh38)
Location 21:6140689-6140711
Sequence GCGTGTGCCCGTGTGTGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176386472_1176386486 23 Left 1176386472 21:6140643-6140665 CCCAGGAGGGTGGACTCTGGCAG No data
Right 1176386486 21:6140689-6140711 GCGTGTGCCCGTGTGTGCTTGGG No data
1176386473_1176386486 22 Left 1176386473 21:6140644-6140666 CCAGGAGGGTGGACTCTGGCAGG No data
Right 1176386486 21:6140689-6140711 GCGTGTGCCCGTGTGTGCTTGGG No data
1176386483_1176386486 -7 Left 1176386483 21:6140673-6140695 CCCGGAGGTGGGAGGGGCGTGTG No data
Right 1176386486 21:6140689-6140711 GCGTGTGCCCGTGTGTGCTTGGG No data
1176386469_1176386486 30 Left 1176386469 21:6140636-6140658 CCCTGTGCCCAGGAGGGTGGACT No data
Right 1176386486 21:6140689-6140711 GCGTGTGCCCGTGTGTGCTTGGG No data
1176386470_1176386486 29 Left 1176386470 21:6140637-6140659 CCTGTGCCCAGGAGGGTGGACTC No data
Right 1176386486 21:6140689-6140711 GCGTGTGCCCGTGTGTGCTTGGG No data
1176386484_1176386486 -8 Left 1176386484 21:6140674-6140696 CCGGAGGTGGGAGGGGCGTGTGC No data
Right 1176386486 21:6140689-6140711 GCGTGTGCCCGTGTGTGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176386486 Original CRISPR GCGTGTGCCCGTGTGTGCTT GGG Intergenic
No off target data available for this crispr