ID: 1176387606

View in Genome Browser
Species Human (GRCh38)
Location 21:6146605-6146627
Sequence AATCACATGAGCCAGTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176387606_1176387610 21 Left 1176387606 21:6146605-6146627 CCAGGGAACTGGCTCATGTGATT No data
Right 1176387610 21:6146649-6146671 GACCTGCCACCTGGAGACGGAGG No data
1176387606_1176387609 18 Left 1176387606 21:6146605-6146627 CCAGGGAACTGGCTCATGTGATT No data
Right 1176387609 21:6146646-6146668 TGAGACCTGCCACCTGGAGACGG No data
1176387606_1176387613 25 Left 1176387606 21:6146605-6146627 CCAGGGAACTGGCTCATGTGATT No data
Right 1176387613 21:6146653-6146675 TGCCACCTGGAGACGGAGGAGGG No data
1176387606_1176387612 24 Left 1176387606 21:6146605-6146627 CCAGGGAACTGGCTCATGTGATT No data
Right 1176387612 21:6146652-6146674 CTGCCACCTGGAGACGGAGGAGG No data
1176387606_1176387607 12 Left 1176387606 21:6146605-6146627 CCAGGGAACTGGCTCATGTGATT No data
Right 1176387607 21:6146640-6146662 ATGTCCTGAGACCTGCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176387606 Original CRISPR AATCACATGAGCCAGTTCCC TGG (reversed) Intergenic
No off target data available for this crispr