ID: 1176387709

View in Genome Browser
Species Human (GRCh38)
Location 21:6147232-6147254
Sequence AATGGCCTTGTGAGGACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176387700_1176387709 12 Left 1176387700 21:6147197-6147219 CCGCCAATAGCCTGTGAGGAGCT No data
Right 1176387709 21:6147232-6147254 AATGGCCTTGTGAGGACTGGAGG No data
1176387697_1176387709 16 Left 1176387697 21:6147193-6147215 CCTCCCGCCAATAGCCTGTGAGG No data
Right 1176387709 21:6147232-6147254 AATGGCCTTGTGAGGACTGGAGG No data
1176387696_1176387709 29 Left 1176387696 21:6147180-6147202 CCAGGGACTGAGGCCTCCCGCCA No data
Right 1176387709 21:6147232-6147254 AATGGCCTTGTGAGGACTGGAGG No data
1176387702_1176387709 2 Left 1176387702 21:6147207-6147229 CCTGTGAGGAGCTGCAGCCTCCA No data
Right 1176387709 21:6147232-6147254 AATGGCCTTGTGAGGACTGGAGG No data
1176387701_1176387709 9 Left 1176387701 21:6147200-6147222 CCAATAGCCTGTGAGGAGCTGCA No data
Right 1176387709 21:6147232-6147254 AATGGCCTTGTGAGGACTGGAGG No data
1176387699_1176387709 13 Left 1176387699 21:6147196-6147218 CCCGCCAATAGCCTGTGAGGAGC No data
Right 1176387709 21:6147232-6147254 AATGGCCTTGTGAGGACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176387709 Original CRISPR AATGGCCTTGTGAGGACTGG AGG Intergenic
No off target data available for this crispr