ID: 1176388186

View in Genome Browser
Species Human (GRCh38)
Location 21:6150146-6150168
Sequence CGCCCTGGGGTTGCGTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176388186_1176388192 -7 Left 1176388186 21:6150146-6150168 CCCTCAGACGCAACCCCAGGGCG No data
Right 1176388192 21:6150162-6150184 CAGGGCGTCAGCAACTGGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176388186 Original CRISPR CGCCCTGGGGTTGCGTCTGA GGG (reversed) Intergenic
No off target data available for this crispr