ID: 1176389219

View in Genome Browser
Species Human (GRCh38)
Location 21:6155030-6155052
Sequence GTGTGGATAGTGAGGATCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176389219_1176389223 -10 Left 1176389219 21:6155030-6155052 CCCGGGATCCTCACTATCCACAC No data
Right 1176389223 21:6155043-6155065 CTATCCACACGGCTTGTTGCTGG No data
1176389219_1176389234 29 Left 1176389219 21:6155030-6155052 CCCGGGATCCTCACTATCCACAC No data
Right 1176389234 21:6155082-6155104 TTCTTTGGAGGCTCGGGGGAGGG No data
1176389219_1176389228 22 Left 1176389219 21:6155030-6155052 CCCGGGATCCTCACTATCCACAC No data
Right 1176389228 21:6155075-6155097 GGCTCCTTTCTTTGGAGGCTCGG No data
1176389219_1176389225 1 Left 1176389219 21:6155030-6155052 CCCGGGATCCTCACTATCCACAC No data
Right 1176389225 21:6155054-6155076 GCTTGTTGCTGGATAAACAACGG No data
1176389219_1176389235 30 Left 1176389219 21:6155030-6155052 CCCGGGATCCTCACTATCCACAC No data
Right 1176389235 21:6155083-6155105 TCTTTGGAGGCTCGGGGGAGGGG No data
1176389219_1176389230 24 Left 1176389219 21:6155030-6155052 CCCGGGATCCTCACTATCCACAC No data
Right 1176389230 21:6155077-6155099 CTCCTTTCTTTGGAGGCTCGGGG No data
1176389219_1176389233 28 Left 1176389219 21:6155030-6155052 CCCGGGATCCTCACTATCCACAC No data
Right 1176389233 21:6155081-6155103 TTTCTTTGGAGGCTCGGGGGAGG No data
1176389219_1176389229 23 Left 1176389219 21:6155030-6155052 CCCGGGATCCTCACTATCCACAC No data
Right 1176389229 21:6155076-6155098 GCTCCTTTCTTTGGAGGCTCGGG No data
1176389219_1176389226 14 Left 1176389219 21:6155030-6155052 CCCGGGATCCTCACTATCCACAC No data
Right 1176389226 21:6155067-6155089 TAAACAACGGCTCCTTTCTTTGG No data
1176389219_1176389231 25 Left 1176389219 21:6155030-6155052 CCCGGGATCCTCACTATCCACAC No data
Right 1176389231 21:6155078-6155100 TCCTTTCTTTGGAGGCTCGGGGG No data
1176389219_1176389227 17 Left 1176389219 21:6155030-6155052 CCCGGGATCCTCACTATCCACAC No data
Right 1176389227 21:6155070-6155092 ACAACGGCTCCTTTCTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176389219 Original CRISPR GTGTGGATAGTGAGGATCCC GGG (reversed) Intergenic
No off target data available for this crispr