ID: 1176389631

View in Genome Browser
Species Human (GRCh38)
Location 21:6156900-6156922
Sequence TGCCCCAGAGGCCCCACCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176389631_1176389634 2 Left 1176389631 21:6156900-6156922 CCTTTGGTGGGGCCTCTGGGGCA No data
Right 1176389634 21:6156925-6156947 TCCACCCCCAGTCCCCAGAGAGG No data
1176389631_1176389646 17 Left 1176389631 21:6156900-6156922 CCTTTGGTGGGGCCTCTGGGGCA No data
Right 1176389646 21:6156940-6156962 CAGAGAGGAAGTGGGGAGCGCGG No data
1176389631_1176389642 10 Left 1176389631 21:6156900-6156922 CCTTTGGTGGGGCCTCTGGGGCA No data
Right 1176389642 21:6156933-6156955 CAGTCCCCAGAGAGGAAGTGGGG No data
1176389631_1176389641 9 Left 1176389631 21:6156900-6156922 CCTTTGGTGGGGCCTCTGGGGCA No data
Right 1176389641 21:6156932-6156954 CCAGTCCCCAGAGAGGAAGTGGG No data
1176389631_1176389639 8 Left 1176389631 21:6156900-6156922 CCTTTGGTGGGGCCTCTGGGGCA No data
Right 1176389639 21:6156931-6156953 CCCAGTCCCCAGAGAGGAAGTGG No data
1176389631_1176389647 18 Left 1176389631 21:6156900-6156922 CCTTTGGTGGGGCCTCTGGGGCA No data
Right 1176389647 21:6156941-6156963 AGAGAGGAAGTGGGGAGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176389631 Original CRISPR TGCCCCAGAGGCCCCACCAA AGG (reversed) Intergenic