ID: 1176391128

View in Genome Browser
Species Human (GRCh38)
Location 21:6216075-6216097
Sequence CAGCTTCAGAATTCTGTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176391128_1176391133 -3 Left 1176391128 21:6216075-6216097 CCCCCTACAGAATTCTGAAGCTG No data
Right 1176391133 21:6216095-6216117 CTGTTCATAAGCAGGCCACGTGG No data
1176391128_1176391135 29 Left 1176391128 21:6216075-6216097 CCCCCTACAGAATTCTGAAGCTG No data
Right 1176391135 21:6216127-6216149 CTCAAAAGCTGTTGAGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176391128 Original CRISPR CAGCTTCAGAATTCTGTAGG GGG (reversed) Intergenic
No off target data available for this crispr