ID: 1176391461

View in Genome Browser
Species Human (GRCh38)
Location 21:6218160-6218182
Sequence TAGTCTAAGGAGAAAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176391461_1176391466 9 Left 1176391461 21:6218160-6218182 CCTGCCTCTTTCTCCTTAGACTA No data
Right 1176391466 21:6218192-6218214 CACTGAGCTGGGTGCATGCTAGG No data
1176391461_1176391465 -2 Left 1176391461 21:6218160-6218182 CCTGCCTCTTTCTCCTTAGACTA No data
Right 1176391465 21:6218181-6218203 TAGCGCACTGTCACTGAGCTGGG No data
1176391461_1176391464 -3 Left 1176391461 21:6218160-6218182 CCTGCCTCTTTCTCCTTAGACTA No data
Right 1176391464 21:6218180-6218202 CTAGCGCACTGTCACTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176391461 Original CRISPR TAGTCTAAGGAGAAAGAGGC AGG (reversed) Intergenic
No off target data available for this crispr