ID: 1176391766

View in Genome Browser
Species Human (GRCh38)
Location 21:6220231-6220253
Sequence TCCCGATGTTGGGGGAGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176391761_1176391766 6 Left 1176391761 21:6220202-6220224 CCGTAAAAAAAGGAAATTTGTTT No data
Right 1176391766 21:6220231-6220253 TCCCGATGTTGGGGGAGCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176391766 Original CRISPR TCCCGATGTTGGGGGAGCGT TGG Intergenic
No off target data available for this crispr