ID: 1176393067

View in Genome Browser
Species Human (GRCh38)
Location 21:6235914-6235936
Sequence CTGCAAAAGAGGACCACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 5, 1: 1, 2: 6, 3: 13, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176393060_1176393067 9 Left 1176393060 21:6235882-6235904 CCATTGACTAAAAGCTAAGGCCC 0: 5
1: 1
2: 5
3: 3
4: 87
Right 1176393067 21:6235914-6235936 CTGCAAAAGAGGACCACTGAAGG 0: 5
1: 1
2: 6
3: 13
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176393067 Original CRISPR CTGCAAAAGAGGACCACTGA AGG Intergenic
900645860 1:3708499-3708521 CTGTAAAAGGGGAGCAGTGATGG - Intronic
903677013 1:25070842-25070864 CTGCAAAAAAACACCACAGATGG - Intergenic
904917025 1:33977514-33977536 AGGCAACAGAGCACCACTGAGGG - Intronic
905821711 1:40997802-40997824 GTGGAAATGGGGACCACTGATGG + Intronic
911040217 1:93585258-93585280 CTGCATAAGGGAGCCACTGAAGG + Intronic
914222952 1:145696671-145696693 CTGTAATAGAAGACCACGGAAGG - Intronic
914237835 1:145828303-145828325 GAGCAAAGGAAGACCACTGAAGG + Intronic
915262342 1:154686122-154686144 CTGCAAAAGGGGAATAATGATGG - Intergenic
915859087 1:159422812-159422834 GTGAAAATGAGGACCACTGGGGG + Intergenic
917262776 1:173187943-173187965 CTGAAAAAGAGGACCACTTATGG + Intronic
921180898 1:212630478-212630500 CTGCAAGACAGGTCCCCTGAGGG + Intergenic
921412201 1:214847823-214847845 CTGGAAAACAGCAGCACTGACGG + Intergenic
922678308 1:227567414-227567436 CTGCAAAAGAAGGTCATTGAAGG + Intronic
923050471 1:230388115-230388137 CTGCAATGGAGAGCCACTGAAGG + Intronic
1063680240 10:8180365-8180387 CTACAAAAGAGAATCATTGAAGG - Intergenic
1067088205 10:43253852-43253874 CTGCAAAAAAGTCCCACAGATGG - Intronic
1071482177 10:86073248-86073270 CTCCAACAGAGCACCCCTGAGGG + Intronic
1072253849 10:93601675-93601697 CTGCACAAGTGGACCTCAGAAGG - Intronic
1077103041 11:830553-830575 ATGCAAAAGAGGTACACGGAGGG - Intronic
1077500072 11:2905362-2905384 CTGCCAAAGCGGACCACTGGAGG + Intronic
1078250628 11:9613849-9613871 CTCCTAAAAAGGACCACTGCAGG + Intergenic
1078439708 11:11354242-11354264 CTGCAATAGAGTAGAACTGAAGG + Intronic
1080773291 11:35362414-35362436 CTCCAAAAGATGTCCACTGCAGG - Intronic
1083639954 11:64140113-64140135 CTGCCAGAGAAGACCCCTGAAGG - Intronic
1088432055 11:109769291-109769313 CTGGAAAGGAGCAGCACTGAGGG - Intergenic
1090157944 11:124461236-124461258 CTGCACATCAGCACCACTGAGGG + Intergenic
1091902106 12:4152802-4152824 CTGTAAAACAGGACCAGTGGAGG - Intergenic
1092047265 12:5440711-5440733 CAGGAAAAGAGGCCCACGGAGGG - Intronic
1092321649 12:7482730-7482752 CTGCAATAAAGGATGACTGACGG + Exonic
1092448031 12:8575773-8575795 CTGTAACAGAAGACCAATGATGG - Intergenic
1094280358 12:28730492-28730514 CTGTAGGAGAGGACCACTGATGG - Intergenic
1094616609 12:32041984-32042006 GTGCAACACAGGACCACTGGTGG - Intergenic
1100715775 12:97303545-97303567 GAACAAAGGAGGACCACTGAAGG + Intergenic
1104073944 12:125373004-125373026 TTGCCAAAGAGGACCACATAGGG - Intronic
1104367022 12:128187291-128187313 CTGCCAAACATGATCACTGAGGG + Intergenic
1105268538 13:18847049-18847071 CTGCAAAAGAGGAATGGTGAGGG + Intergenic
1105424789 13:20285001-20285023 CTGCAAATGTGGACCACTGGAGG + Intergenic
1107014282 13:35696110-35696132 CTTCAAAGGAGAACCACTGCAGG + Intergenic
1107818581 13:44266320-44266342 ATGAAAAAGAGCACCACTGCAGG + Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1110243967 13:73300510-73300532 CTGAAAACCAGGAACACTGATGG - Intergenic
1113219720 13:108085934-108085956 TTCCAAATCAGGACCACTGATGG - Intergenic
1113247369 13:108412579-108412601 CTGCAAAGGAGGAAGACAGAGGG + Intergenic
1116193992 14:41698562-41698584 CTGCACAAGAGAACCACCTAGGG - Intronic
1117678056 14:58175058-58175080 ATGCTAAAGAGGGCTACTGAGGG + Intronic
1120423272 14:84315417-84315439 GTGGAAATGTGGACCACTGAGGG - Intergenic
1121795359 14:96730308-96730330 CTGCAGAAGAGGCCCTTTGAGGG + Intergenic
1123833375 15:24164484-24164506 CTCCAAAAGTGGAGCACTCATGG + Intergenic
1124681816 15:31738438-31738460 CTACAAAAGAGGTCCAGGGAGGG + Intronic
1125075887 15:35617804-35617826 TTGAAAAAGAGGACAGCTGAAGG + Intergenic
1127981381 15:64037778-64037800 CTGGAAGAGAGGACCTCTAAAGG + Intronic
1129959610 15:79671946-79671968 CTGCAAAAGAGGACAACTTATGG - Intergenic
1135332086 16:21568993-21569015 CTACAACAGAGGACCAAGGATGG - Intergenic
1135683632 16:24479988-24480010 CTGCATTAGAGGAACACTGGTGG - Intergenic
1135755202 16:25091571-25091593 GAGCAACAGAGAACCACTGATGG + Intergenic
1137958148 16:52853411-52853433 TTGGAAATGTGGACCACTGAGGG + Intergenic
1138157621 16:54720700-54720722 CTGCACATGGGGAACACTGAAGG - Intergenic
1143504235 17:7355190-7355212 CTCCACATGAGGACCACTGGGGG - Exonic
1145995890 17:29104748-29104770 GTGGAAAAGAGGACCTCAGAGGG + Intronic
1146607839 17:34277006-34277028 GTGCAAAAGAGGACCAACGTAGG - Intergenic
1148948612 17:51288436-51288458 CTGAAAATGAGGACCACTTTAGG - Intronic
1152603853 17:81278988-81279010 CTGCAAAGGAGCTCCACAGATGG + Intronic
1203166873 17_GL000205v2_random:105523-105545 CTGCAAAAGGGGGCCACTGAAGG + Intergenic
1157583332 18:48786059-48786081 CTGCAAAGGAGGAAGAATGATGG - Intronic
1159344564 18:67183547-67183569 CTGTAAGAGAGGAAGACTGATGG + Intergenic
1161956255 19:7497190-7497212 CTGCAAAAGGGGACTAATGATGG - Intronic
1165251299 19:34538156-34538178 CTGGAAAAAAGGCCAACTGAAGG - Intergenic
1165813009 19:38623617-38623639 TTGCAAAAGAGGACAACAGAAGG - Intronic
926207878 2:10846967-10846989 GTTCAAGAGAGCACCACTGAGGG - Intergenic
926634034 2:15161973-15161995 CTGGAGGAGAGGAACACTGAGGG - Intergenic
929011530 2:37450009-37450031 CCCCAGAAGAGGACCTCTGATGG + Intergenic
931357621 2:61550861-61550883 GAGGAAAAGAGGACCACTAAAGG + Intergenic
931470941 2:62537145-62537167 GTACAAAGGAGGGCCACTGAAGG - Intergenic
932139537 2:69263333-69263355 CTGGTGAAGAGGGCCACTGATGG + Intergenic
932759285 2:74428927-74428949 GTGGTAACGAGGACCACTGAGGG + Exonic
933155442 2:78968046-78968068 TTGCAAAAGAGAATCCCTGATGG - Intergenic
934497761 2:94824330-94824352 CTGCAAAAGAGGAATGGTGAGGG + Intergenic
934991199 2:98922703-98922725 CTGCAAAACAGGGCCACGGAGGG + Intronic
937635205 2:124147799-124147821 TTGGAGAAGAGGAACACTGAAGG - Intronic
938505261 2:131873454-131873476 CTGCAAATGAGGACAATTTATGG - Intergenic
941286871 2:163625428-163625450 CTGCAAAAAAGGAACAATCAGGG - Intronic
942141495 2:172981538-172981560 CTGCTAAAGGTCACCACTGAGGG - Intronic
942340620 2:174941702-174941724 TTGCAAAAGAGAAGCACAGAAGG - Intronic
943143201 2:184009137-184009159 CTTCTAAAGAGGGCTACTGATGG - Intergenic
943370951 2:187015024-187015046 CTGTAATAAAGGACCACAGACGG + Intergenic
943939633 2:193975657-193975679 CTGCAAAAGATTCTCACTGAAGG - Intergenic
944187674 2:196967388-196967410 CTGCAAAACAGGCACCCTGAGGG - Intronic
944897900 2:204184322-204184344 CAGCAAAAGATGACCACTCTGGG + Intergenic
945841248 2:214890357-214890379 CTGCAAAAGAGGTCCCCTCCAGG - Intergenic
947138809 2:227001713-227001735 CTGCAAAATAGGACAGCTGTAGG + Intergenic
947815592 2:233034367-233034389 CTGCAAAGGTGGACCACTCCCGG - Exonic
1169146853 20:3258390-3258412 CTGCTGTAGGGGACCACTGAGGG - Intronic
1170961027 20:21026190-21026212 TGGCAAAGGAGGACAACTGATGG - Intergenic
1172233999 20:33357394-33357416 CTGAAAAAGAGGTCCACTGGTGG + Intergenic
1172763894 20:37340687-37340709 CTGCAGAAGAGGCCCAGAGAAGG - Intergenic
1173230585 20:41192917-41192939 GTGGAAATGTGGACCACTGAGGG + Intronic
1174133416 20:48361806-48361828 CAGCAATAGAGGACTACTGAAGG - Intergenic
1175337817 20:58207401-58207423 CTGCAAAAGATGACTGTTGATGG + Intergenic
1175749540 20:61485683-61485705 GTGCAGAACAGGACCACTGCAGG + Intronic
1176293232 21:5057262-5057284 CTGCAACAGAGGACCACAGGCGG + Intergenic
1176334690 21:5585034-5585056 CTGCAAAAGAGGACCACTGAAGG - Intergenic
1176393067 21:6235914-6235936 CTGCAAAAGAGGACCACTGAAGG + Intergenic
1176404882 21:6353574-6353596 CTGCAAAAGGGGGCCACTGAAGG - Intergenic
1176432275 21:6635530-6635552 CTGCAAAAGGGGGCCACTGAAGG + Intergenic
1176468352 21:7080260-7080282 CTGCAAAAGAGGACCACTGAAGG - Intronic
1176491913 21:7462038-7462060 CTGCAAAAGAGGACCACTGAAGG - Intergenic
1176508729 21:7676345-7676367 CTGCAAAAGAGGACCACTGAAGG + Intergenic
1176853818 21:13946344-13946366 CTGCAAAAGAGGAATGGTGAGGG + Intergenic
1179864028 21:44206388-44206410 CTGCAACAGAGGACCACAGGCGG - Intergenic
1180214738 21:46316968-46316990 CTGCAAAATGGGAACAATGAAGG + Intronic
1181037733 22:20178051-20178073 CTGGAAAACAGGACCCCTGAAGG - Intergenic
1181408931 22:22704501-22704523 CTGCAAGAGAGGACAAGAGAGGG - Intergenic
1181977147 22:26738121-26738143 CTGCACATGAGAACCAGTGAGGG + Intergenic
1183224738 22:36541880-36541902 CTGCAGATGAGGAAGACTGAGGG + Intergenic
951549826 3:23865895-23865917 CAGCTAAAGAGGCCCACAGATGG - Intronic
954495051 3:50950520-50950542 CTGCAAATGAGCACTACTGTGGG - Intronic
955763678 3:62317633-62317655 CTAGAACAGAGGACCACTCAAGG + Intergenic
956198295 3:66676253-66676275 TTGCAAGAGAGTACCATTGAAGG - Intergenic
956319008 3:67974462-67974484 TTGCAAAATTGTACCACTGAAGG + Intergenic
958913143 3:100017799-100017821 CTGAAAACCAGGAGCACTGAAGG - Intronic
961065341 3:123870369-123870391 CTGCAGCAGAGTACCACTGAAGG + Intronic
964685280 3:159388618-159388640 GTGAAAAAGAGGAACATTGAGGG + Intronic
964967590 3:162516036-162516058 AAGCAAAAGTGGACCAATGATGG - Intergenic
967569323 3:191010211-191010233 TTCCAAAAGAGGCCCACTCATGG + Intergenic
970730061 4:19092024-19092046 GTGTGACAGAGGACCACTGAAGG - Intergenic
971147552 4:23995456-23995478 ATGCTACTGAGGACCACTGAGGG - Intergenic
971434056 4:26600695-26600717 CAGCAAAAGAAAACCAGTGAGGG + Intronic
972844639 4:42972844-42972866 CTGCTAAAGAGTAGAACTGAAGG - Intronic
973798795 4:54455728-54455750 CTGCAAAAGAGGTACAAGGATGG + Intergenic
977341437 4:95763715-95763737 CTGCAAAATATGGCCACTGTTGG - Intergenic
980691923 4:136306235-136306257 CTGCAAAAGAAGACGTCTAAAGG - Intergenic
980891681 4:138822153-138822175 ATGCAAATCAGGACAACTGAAGG + Intergenic
981566219 4:146104582-146104604 CTACAAGTGAGGGCCACTGATGG + Intergenic
984933174 4:184866649-184866671 CTGCCAATGAGGACCACTAGAGG + Intergenic
986416954 5:7538350-7538372 CGGTAAAAGAGGACCAATAATGG + Intronic
988077288 5:26368401-26368423 CTGGGAAAGTGGACCACTGGGGG + Intergenic
989454626 5:41628793-41628815 TTGAAATAGAGGACCACGGAAGG + Intergenic
990059633 5:51631242-51631264 TTGCAAAAGAGGACATTTGACGG + Intergenic
992958189 5:81931913-81931935 CTGGAAAAAAGAACCATTGAAGG - Intergenic
994091624 5:95814687-95814709 ATGCCAAAGAGGACAATTGAGGG + Exonic
994554903 5:101287180-101287202 GTGCAATAGAGAACAACTGATGG - Intergenic
995055947 5:107758760-107758782 GTGCACAAGAGGAACACAGAAGG + Intergenic
996763009 5:127004791-127004813 TTGCCAAAGAGCACCAATGAAGG - Intronic
998930437 5:147175429-147175451 ATGAAAAAGAGGACCAGAGAAGG - Intergenic
1000277475 5:159751130-159751152 CTGCAAAATGGGAACAGTGACGG + Intergenic
1001635645 5:173208282-173208304 GTGCAAAAGAGAAAAACTGATGG - Intergenic
1001693339 5:173649274-173649296 GTGCAAAATAGGACCACATATGG + Intergenic
1003848435 6:10197806-10197828 CTGGAACAGAGGAACAATGATGG - Intronic
1006967589 6:38004357-38004379 CTGCAGAGGAGGAACACTGACGG - Intronic
1009703401 6:67213179-67213201 ATGCAAAAGGGGACTACAGATGG - Intergenic
1016385847 6:143530255-143530277 CTGCAGAAGAGGAACCCTGTGGG - Intergenic
1017001678 6:150001745-150001767 CTGCAAATGAAGGCCTCTGAGGG + Intergenic
1017542561 6:155417590-155417612 CTCCTAAAGAGGCCAACTGATGG + Intronic
1019354423 7:571327-571349 CTGCAAAACAGCACCCCTGGAGG - Intronic
1021392995 7:20117252-20117274 TTGCAAAAGAGCTCCAGTGATGG - Intergenic
1022911111 7:34900294-34900316 CTGCAACAGGGGACCACAGCTGG - Intergenic
1023852030 7:44155823-44155845 CTGCAAGGGAGGATCACTCAAGG - Intronic
1024932949 7:54683541-54683563 CTATAAAAGAGGAAAACTGAAGG + Intergenic
1026538357 7:71259144-71259166 ATGAAAAAGAGGCCCTCTGAAGG - Intronic
1028340036 7:89706799-89706821 CTGCAAAAGAACACCTGTGAAGG + Intergenic
1031489795 7:122372318-122372340 GTTCAATAGAGGACCAATGATGG + Intronic
1032433417 7:131881240-131881262 ATGCAAATGAGGACTAATGAAGG - Intergenic
1033347973 7:140540276-140540298 CTGCAGAAGAAAACCCCTGATGG + Intronic
1035085608 7:156254950-156254972 CGGTAACAGAGGACCACAGATGG - Intergenic
1035816814 8:2550173-2550195 CTGTAAAACAGGAGCAATGATGG + Intergenic
1038056344 8:23861812-23861834 CTGCAATAAAGGGCCAGTGAGGG - Intergenic
1042024915 8:64413044-64413066 ATGCAAAAAAGGACCAATGTGGG - Intergenic
1043866143 8:85378065-85378087 CTGCCACAGAGGACCACGCAGGG + Exonic
1043867670 8:85394514-85394536 CAGCAACAGAGGGCCACTCATGG - Intronic
1044149591 8:88758980-88759002 CTGAAAAACAGGAGCATTGAGGG - Intergenic
1048614200 8:136056635-136056657 CTTAAACAGAGGACCCCTGAAGG - Intergenic
1051235084 9:14991100-14991122 CTGCAAACCAGGATCACCGAGGG - Intergenic
1053368316 9:37539827-37539849 TTGCAAATGAGGGCTACTGAAGG - Intronic
1053659385 9:40256143-40256165 CTGCAAAAGAGGAATGGTGAGGG - Intronic
1053909757 9:42885506-42885528 CTGCAAAAGAGGAATGGTGAGGG - Intergenic
1054371512 9:64402444-64402466 CTGCAAAAGAGGAATGGTGAGGG - Intronic
1054525213 9:66120074-66120096 CTGCAAAAGAGGAATGGTGAGGG + Intronic
1054679133 9:67892159-67892181 CTGCAAAAGAGGAATGGTGAGGG - Intronic
1055208270 9:73760248-73760270 CTGTGATAGAGAACCACTGAGGG - Intergenic
1056535855 9:87527030-87527052 CTGTGAAAGAGGACACCTGAAGG + Intronic
1059171820 9:112131911-112131933 CTTCAAAATAGGACTCCTGAGGG + Intronic
1060058804 9:120440185-120440207 CTGAGGAAGAGGACAACTGAGGG - Intronic
1203426948 Un_GL000195v1:49886-49908 CAGCAAAAGAGGACCACTGAAGG + Intergenic
1203439263 Un_GL000195v1:173182-173204 CTGCAAAAGGGGGCCACTGAAGG - Intergenic
1186420181 X:9419536-9419558 ATGCCAATGAGGACCACTGTGGG - Intergenic
1187587338 X:20677964-20677986 CTGCAACAAAGTACCACAGACGG - Intergenic
1189462797 X:41255563-41255585 CTGCAAATGAGGGGCTCTGAGGG - Intergenic
1190072056 X:47287687-47287709 CTTCATAAGGGTACCACTGAAGG + Intergenic
1192615621 X:72618547-72618569 CTATAAATGAGGACAACTGAGGG + Intronic
1196053178 X:111327095-111327117 CTGCTAAAGAGGAGCACTTTTGG + Intronic
1197177559 X:123501581-123501603 CTGGAAAAGATGACCAGTTATGG - Intergenic
1198449632 X:136754283-136754305 GAGCAAAAGAGAACAACTGATGG + Intronic
1199898799 X:152152763-152152785 CTGGAGAAGAGGATCACTGTTGG + Intergenic