ID: 1176393780

View in Genome Browser
Species Human (GRCh38)
Location 21:6242578-6242600
Sequence TGTAATTAAACCCTTAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 5, 1: 0, 2: 1, 3: 10, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176393780_1176393787 7 Left 1176393780 21:6242578-6242600 CCCACCCTAAGGGTTTAATTACA 0: 5
1: 0
2: 1
3: 10
4: 137
Right 1176393787 21:6242608-6242630 TCCTTATAGCATTACGCCCGGGG 0: 5
1: 1
2: 0
3: 6
4: 23
1176393780_1176393786 6 Left 1176393780 21:6242578-6242600 CCCACCCTAAGGGTTTAATTACA 0: 5
1: 0
2: 1
3: 10
4: 137
Right 1176393786 21:6242607-6242629 CTCCTTATAGCATTACGCCCGGG 0: 5
1: 1
2: 0
3: 7
4: 44
1176393780_1176393785 5 Left 1176393780 21:6242578-6242600 CCCACCCTAAGGGTTTAATTACA 0: 5
1: 0
2: 1
3: 10
4: 137
Right 1176393785 21:6242606-6242628 CCTCCTTATAGCATTACGCCCGG 0: 5
1: 1
2: 0
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176393780 Original CRISPR TGTAATTAAACCCTTAGGGT GGG (reversed) Intergenic
901772592 1:11537903-11537925 TGGAATGAATCCCTGAGGGTGGG + Intergenic
905711328 1:40106857-40106879 TATGATTAAACCCTTAGTGATGG + Intergenic
908657239 1:66401193-66401215 TTTAATTAAACCTTTAGGCCAGG - Intergenic
908807408 1:67945596-67945618 TGAAATGAAATCTTTAGGGTGGG + Intergenic
916509582 1:165460166-165460188 GGTAATTGAACCCTAGGGGTGGG - Intergenic
917293134 1:173492228-173492250 TGGAATCAATCCCTGAGGGTAGG - Intergenic
919348845 1:196421969-196421991 TATAATGAGACCATTAGGGTAGG - Intronic
919464914 1:197915470-197915492 TGTAATTAGCCCCTTTGGATGGG - Intronic
920194895 1:204220321-204220343 TGTAATAAAATCCTTAGGCCAGG + Exonic
1069024665 10:63525933-63525955 TGTATTTAATCCCATGGGGTAGG - Intronic
1080878616 11:36298943-36298965 TAAAATGAACCCCTTAGGGTAGG - Intronic
1082192765 11:49267163-49267185 TGTGATTCTTCCCTTAGGGTGGG - Intergenic
1084652980 11:70499892-70499914 TTTAATTAATCCCTTGGAGTTGG - Intronic
1085256099 11:75174095-75174117 TGTAATTAAACTTTTAGGCCTGG - Intronic
1090177260 11:124662117-124662139 TTTAATTAACCTCTTAGGGATGG - Intronic
1090691369 11:129186309-129186331 AGTAATTAAGCCCTTTGGGATGG - Intronic
1091581435 12:1792746-1792768 TGGAGTGAAATCCTTAGGGTTGG - Exonic
1093202716 12:16208714-16208736 TGTATTTAAAACCTTAGGTGTGG - Intronic
1095420670 12:42020805-42020827 TGGAGGAAAACCCTTAGGGTGGG + Intergenic
1100784324 12:98063127-98063149 TGCAATGAAATCCTTAGGGCAGG - Intergenic
1102429658 12:112873191-112873213 TGTGATTAAACCCTTTGCATGGG + Intronic
1103214471 12:119190932-119190954 TGTATTTAAACCCATTTGGTGGG - Intronic
1104578202 12:129987985-129988007 TGTAATTAAACTCTCAGGGAAGG - Intergenic
1104829634 12:131741259-131741281 TGAAATTAAAACCCTAGGCTGGG - Intronic
1105046650 12:133009294-133009316 TGTAATTAAAACCTTTAGGCTGG + Intronic
1105829789 13:24153832-24153854 TGGAATTCATCCCTTGGGGTTGG + Intronic
1108612221 13:52095590-52095612 TAAAATTAAGCCCTTAGGCTGGG + Intronic
1108794494 13:54014853-54014875 GGTAATTAAATCATGAGGGTGGG - Intergenic
1109162863 13:58997584-58997606 AGTAATTAAACCCTGAGATTTGG - Intergenic
1109402452 13:61852992-61853014 TGAAATAAAGCCATTAGGGTAGG + Intergenic
1109466063 13:62733009-62733031 TGTAATTATATCCTCAGAGTAGG + Intergenic
1110937334 13:81307434-81307456 TGTGATTCTTCCCTTAGGGTGGG - Intergenic
1111459804 13:88524291-88524313 TGTGATTAAATTCATAGGGTTGG + Intergenic
1111562278 13:89966974-89966996 TGTAATTAAATCCTTGTCGTAGG - Intergenic
1111740971 13:92205496-92205518 TCTAATGAAACCCTTGGAGTTGG - Intronic
1113511854 13:110862806-110862828 TGTGAATAAAGCCTGAGGGTGGG - Intergenic
1114022248 14:18490809-18490831 TGTTCTGAAATCCTTAGGGTTGG - Intergenic
1116463356 14:45203616-45203638 TGTAATTTAAACATTAGGTTTGG + Exonic
1116876194 14:50114538-50114560 TGTAATTAAAGCTCTAGGCTAGG + Intronic
1117877756 14:60273392-60273414 TGTAAGAAAACCCTTGTGGTTGG + Intronic
1120667534 14:87324527-87324549 TGTAATGAGACCATGAGGGTCGG - Intergenic
1126605210 15:50469447-50469469 GGTAAATATACCCCTAGGGTTGG + Intronic
1126669028 15:51099514-51099536 TATAAATAACCCCATAGGGTTGG - Intronic
1127067095 15:55251995-55252017 TGTACTTAATCCCTGTGGGTTGG - Intronic
1130616921 15:85419015-85419037 TCTAATTAAACCCTTAAGGGTGG - Intronic
1132101353 15:99025635-99025657 TGCAAATAAAGCCTAAGGGTTGG + Intergenic
1133185039 16:4089938-4089960 TGTAATTCAAGCCTGTGGGTAGG - Intronic
1134369042 16:13606545-13606567 TGTAATTCCTCCCTTAGCGTGGG - Intergenic
1135470917 16:22729961-22729983 TTTAATTAGACCCTTACTGTTGG - Intergenic
1135489833 16:22899820-22899842 GGTAATTAAATCATGAGGGTGGG - Intronic
1137755673 16:50900148-50900170 TGTAATTAAACCAGCAGGGGTGG + Intergenic
1137987789 16:53124818-53124840 GGTAATTAAATCATGAGGGTGGG - Intronic
1141384841 16:83611327-83611349 TGAAATTAAACCTTTGGGGTAGG - Intronic
1146785788 17:35720192-35720214 TGCATCTAAACCCTTAGGGTCGG - Intronic
1203167574 17_GL000205v2_random:112265-112287 TGTACTTAACTCCTGAGGGTGGG - Intergenic
1158908266 18:62035011-62035033 GGTAATTAAACCATGGGGGTGGG + Intergenic
1158928967 18:62302329-62302351 GGTAATTAAAGGCTTATGGTTGG + Intronic
1161635669 19:5387407-5387429 TGTAATTAATGCCTCAGGATAGG + Intergenic
1161755160 19:6127663-6127685 TATTATTAAATCCTTAGGGATGG - Intronic
1165543551 19:36513304-36513326 TGTTTTTAAAACCTTAGGGCAGG - Exonic
1166037857 19:40182294-40182316 GGTAATTAAAATCTTAAGGTTGG + Intergenic
1166967220 19:46536365-46536387 TGAAAATAAACCTTTAGGCTTGG - Intronic
929260856 2:39864823-39864845 TGTAATTGAATCATGAGGGTGGG + Intergenic
932316220 2:70785286-70785308 TTTAATGAAAGCCTTTGGGTGGG - Intronic
934147518 2:89110166-89110188 TGAAGTCAAACCCTTGGGGTTGG - Intergenic
934221752 2:90090425-90090447 TGAAGTCAAACCCTTGGGGTTGG + Intergenic
934232274 2:90194806-90194828 TGAAGTCAAACCCTTGGGGTTGG + Intergenic
936913850 2:117619273-117619295 TGTATTTTAAACCTTAGGGCAGG + Intergenic
945399086 2:209357335-209357357 TGTAGTTAAAACCTTGGGGAAGG + Intergenic
945557049 2:211290285-211290307 GGTAATTAATCCCTTAGAATAGG - Intergenic
946669297 2:222085213-222085235 GGTAATTAAATCATTGGGGTGGG + Intergenic
947256247 2:228167101-228167123 TGAAATTTAACCCTCAGTGTTGG - Intronic
1169946540 20:10995146-10995168 TGTGAGTACACCCTTAGGGCTGG - Intergenic
1176333977 21:5578374-5578396 TGTAATTAAACCCTTAGGGTGGG + Intergenic
1176393780 21:6242578-6242600 TGTAATTAAACCCTTAGGGTGGG - Intergenic
1176404184 21:6346870-6346892 TGTACTTAACTCCTGAGGGTGGG + Intergenic
1176432973 21:6642234-6642256 TGTACTTAACTCCTGAGGGTGGG - Intergenic
1176467639 21:7073596-7073618 TGTAATTAAACCCTTAGGGTGGG + Intronic
1176491200 21:7455374-7455396 TGTAATTAAACCCTTAGGGTGGG + Intergenic
1176509442 21:7683009-7683031 TGTAATTAAACCCTTAGGGTGGG - Intergenic
1179877796 21:44280062-44280084 TGTAATAAAATCCTTAGAGTGGG + Intergenic
950816200 3:15705287-15705309 TATAATTCAACCCATAGTGTTGG - Intronic
953577782 3:44127136-44127158 TCAAATTAAACTCTTAGGGTAGG - Intergenic
955102079 3:55860068-55860090 TATAATTAAAACCTTCGGGTGGG - Intronic
955854099 3:63254825-63254847 TATAATGAAAGCATTAGGGTGGG + Intronic
957975268 3:87435020-87435042 TGTAATTAAAACCTTAAGTATGG - Intergenic
959649504 3:108737923-108737945 CATAATTCATCCCTTAGGGTGGG - Intergenic
962302387 3:134253796-134253818 TTTAATTAAACCCTTGGAGAAGG + Intergenic
962893400 3:139692656-139692678 TGTAATTAAACCCTATGAGGTGG - Intergenic
963187428 3:142434943-142434965 TATTTTTAAACTCTTAGGGTAGG + Intronic
965649632 3:170919905-170919927 TGTAATTAAATCATGGGGGTAGG + Intergenic
968326411 3:197821023-197821045 TGTAATTAATAACTCAGGGTAGG + Intronic
969761628 4:9188851-9188873 TGAAACTATACTCTTAGGGTTGG + Intergenic
972124659 4:35748218-35748240 TGAAATGAAACCATTAAGGTGGG - Intergenic
974587712 4:63900890-63900912 TCTAAATAAACCCTTAGAGCTGG - Intergenic
975456361 4:74596119-74596141 GGTAATTAAATCATGAGGGTGGG + Intergenic
976321252 4:83718604-83718626 AGTAATGAGACCATTAGGGTGGG - Intergenic
976425007 4:84893043-84893065 TGTAATGAAACCAGTAGAGTTGG + Intronic
979867771 4:125777332-125777354 GGTAATTGAACCTTGAGGGTGGG + Intergenic
980313326 4:131163616-131163638 TGAAATGAGACCATTAGGGTGGG + Intergenic
981012833 4:139943454-139943476 TGTAATTGGAGCCATAGGGTGGG + Intronic
981020148 4:140018809-140018831 TGTAACTAATCCCTTAATGTTGG + Intronic
981426290 4:144607345-144607367 TGTATTTAAACTTTTAGGTTTGG - Intergenic
982168443 4:152637870-152637892 TTTAATTAAAACATTAGGATAGG + Intronic
982201464 4:152965477-152965499 TGTAATTAGAGCCTTATGTTTGG - Intronic
982390800 4:154862182-154862204 TGAAATGTAACCCTTAGTGTTGG - Intergenic
983259003 4:165434806-165434828 TGAAATTTGACCCTTAGTGTTGG + Intronic
987118728 5:14746844-14746866 TGTAATAAAACCCAAAGGGAGGG - Intronic
987572071 5:19676786-19676808 TGTGATTTTTCCCTTAGGGTGGG - Intronic
987587965 5:19881846-19881868 TGTAATTAAGCCCATCAGGTAGG - Intronic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
990786460 5:59425990-59426012 TTTAAATAAGCCTTTAGGGTGGG + Intronic
994515420 5:100766183-100766205 TGTAATTGACCCTTTAGGGGAGG - Intergenic
997471097 5:134117375-134117397 TGTAAATAAACCCTTAGATTTGG + Intronic
1007236587 6:40394740-40394762 GGTAATTAAATCATGAGGGTGGG + Intronic
1007713084 6:43837146-43837168 TGTAGGTAAACCCTCAGTGTTGG + Intergenic
1007855990 6:44858161-44858183 TATAATTGAACCTTGAGGGTAGG + Intronic
1010564633 6:77394688-77394710 TGTGAGTAAAACCTTGGGGTTGG - Intergenic
1011221941 6:85064053-85064075 TAAAATGAGACCCTTAGGGTGGG + Intergenic
1011913131 6:92467090-92467112 TGTAATTAAATCATTGGGTTAGG - Intergenic
1015102187 6:129494575-129494597 TGTAAATAAAACAATAGGGTGGG - Intronic
1015440861 6:133243576-133243598 TGTTTTTAAAACCTTAGGGAAGG + Intronic
1015752015 6:136569836-136569858 TGTAATTAAATCCTTAAACTTGG + Intronic
1016422848 6:143902791-143902813 CATAATTAAGCCCTTGGGGTTGG - Intronic
1017132129 6:151116695-151116717 TGTATTTAAATACTTTGGGTTGG + Intergenic
1018321929 6:162620492-162620514 TGTAATTAGATCCTTAGGGAAGG + Intronic
1018694396 6:166380640-166380662 TGTAATGAAACTGTTAGGGCCGG + Intronic
1018811727 6:167303095-167303117 TGGAATGAACCCCTTTGGGTGGG + Intronic
1021506430 7:21390522-21390544 GGAAATTAAACACTTAGGGTGGG - Intergenic
1023276161 7:38521015-38521037 TGTGATCAAATCCTTAGGGATGG + Intronic
1028110464 7:86934673-86934695 GGCAATTAAAGCCTTGGGGTTGG - Intronic
1028258363 7:88629836-88629858 TGAAATAAAAACATTAGGGTTGG - Intergenic
1029006865 7:97220119-97220141 TTCAATTAAACCCTAAGGATGGG + Intergenic
1031090822 7:117351599-117351621 TGTGATTCTGCCCTTAGGGTAGG + Intergenic
1032970052 7:137150739-137150761 AGTAACTATACCCTCAGGGTTGG - Intergenic
1034006549 7:147478517-147478539 TGTCATGAAAACCTTTGGGTAGG + Intronic
1034621022 7:152457235-152457257 TGAAATGTAACCCCTAGGGTTGG + Intergenic
1036113858 8:5936370-5936392 TGTAATGGAACCCTGAGGTTGGG - Intergenic
1036676480 8:10838234-10838256 TGTAATTAGATACTTAGGATTGG - Intronic
1038307080 8:26414547-26414569 TGTAATTAAGCACTCAGGGAGGG + Intronic
1039273678 8:35911145-35911167 GGTAATTGAACCATGAGGGTAGG - Intergenic
1047725464 8:127680188-127680210 TGCAAGTAAAGCCTTAGTGTAGG - Intergenic
1056019753 9:82429634-82429656 TCAAATTAGACCTTTAGGGTAGG - Intergenic
1057308799 9:93928432-93928454 TAAAATGAAGCCCTTAGGGTGGG - Intergenic
1058386951 9:104447471-104447493 TGTAATTGAACCATGAGGGCTGG - Intergenic
1059728240 9:117029858-117029880 TATAAAGAAAACCTTAGGGTTGG - Intronic
1203427720 Un_GL000195v1:56845-56867 AGTAATTAACCCCTTAGGGTGGG - Intergenic
1203438562 Un_GL000195v1:166436-166458 TGTACTTAACTCCTGAGGGTGGG + Intergenic
1189682553 X:43531867-43531889 TTTATTTAAACCATTTGGGTGGG - Intergenic
1193032604 X:76915575-76915597 TGTTATTAAACTGTAAGGGTTGG - Intergenic
1194145180 X:90254041-90254063 GGTAATTGAACCATTGGGGTGGG - Intergenic
1198620241 X:138499784-138499806 TATAATTAAATCATTGGGGTGGG + Intergenic
1200490940 Y:3823334-3823356 GGTAATTGAACCATTGGGGTGGG - Intergenic