ID: 1176396092

View in Genome Browser
Species Human (GRCh38)
Location 21:6266987-6267009
Sequence GGTCCTCGATGCTGGCCCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176396081_1176396092 14 Left 1176396081 21:6266950-6266972 CCAGGGACAGCACCGGATGGGCC No data
Right 1176396092 21:6266987-6267009 GGTCCTCGATGCTGGCCCAGCGG No data
1176396084_1176396092 2 Left 1176396084 21:6266962-6266984 CCGGATGGGCCAGGCCGGATGTG No data
Right 1176396092 21:6266987-6267009 GGTCCTCGATGCTGGCCCAGCGG No data
1176396089_1176396092 -7 Left 1176396089 21:6266971-6266993 CCAGGCCGGATGTGGGGGTCCTC No data
Right 1176396092 21:6266987-6267009 GGTCCTCGATGCTGGCCCAGCGG No data
1176396080_1176396092 15 Left 1176396080 21:6266949-6266971 CCCAGGGACAGCACCGGATGGGC No data
Right 1176396092 21:6266987-6267009 GGTCCTCGATGCTGGCCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176396092 Original CRISPR GGTCCTCGATGCTGGCCCAG CGG Intergenic