ID: 1176396609

View in Genome Browser
Species Human (GRCh38)
Location 21:6271570-6271592
Sequence ATGTGAAAAGAGCTGGTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176396601_1176396609 30 Left 1176396601 21:6271517-6271539 CCCAGCGCAGTGTGACTTCTGGA No data
Right 1176396609 21:6271570-6271592 ATGTGAAAAGAGCTGGTTCCCGG No data
1176396603_1176396609 0 Left 1176396603 21:6271547-6271569 CCCCCATCGTCTTACCTCAAATG No data
Right 1176396609 21:6271570-6271592 ATGTGAAAAGAGCTGGTTCCCGG No data
1176396602_1176396609 29 Left 1176396602 21:6271518-6271540 CCAGCGCAGTGTGACTTCTGGAG No data
Right 1176396609 21:6271570-6271592 ATGTGAAAAGAGCTGGTTCCCGG No data
1176396606_1176396609 -3 Left 1176396606 21:6271550-6271572 CCATCGTCTTACCTCAAATGATG No data
Right 1176396609 21:6271570-6271592 ATGTGAAAAGAGCTGGTTCCCGG No data
1176396604_1176396609 -1 Left 1176396604 21:6271548-6271570 CCCCATCGTCTTACCTCAAATGA No data
Right 1176396609 21:6271570-6271592 ATGTGAAAAGAGCTGGTTCCCGG No data
1176396605_1176396609 -2 Left 1176396605 21:6271549-6271571 CCCATCGTCTTACCTCAAATGAT No data
Right 1176396609 21:6271570-6271592 ATGTGAAAAGAGCTGGTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176396609 Original CRISPR ATGTGAAAAGAGCTGGTTCC CGG Intergenic
No off target data available for this crispr