ID: 1176396956

View in Genome Browser
Species Human (GRCh38)
Location 21:6273941-6273963
Sequence AAGTAGACACAAATCCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176396949_1176396956 27 Left 1176396949 21:6273891-6273913 CCCACCTCGGCACAGTCACCTGT No data
Right 1176396956 21:6273941-6273963 AAGTAGACACAAATCCCCATGGG No data
1176396951_1176396956 23 Left 1176396951 21:6273895-6273917 CCTCGGCACAGTCACCTGTAGTG No data
Right 1176396956 21:6273941-6273963 AAGTAGACACAAATCCCCATGGG No data
1176396952_1176396956 9 Left 1176396952 21:6273909-6273931 CCTGTAGTGTACTGAGATGAGCA No data
Right 1176396956 21:6273941-6273963 AAGTAGACACAAATCCCCATGGG No data
1176396950_1176396956 26 Left 1176396950 21:6273892-6273914 CCACCTCGGCACAGTCACCTGTA No data
Right 1176396956 21:6273941-6273963 AAGTAGACACAAATCCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176396956 Original CRISPR AAGTAGACACAAATCCCCAT GGG Intergenic
No off target data available for this crispr