ID: 1176400437

View in Genome Browser
Species Human (GRCh38)
Location 21:6309338-6309360
Sequence CAGAGGAAAAAGGAGCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176400428_1176400437 14 Left 1176400428 21:6309301-6309323 CCTGAGAGTTGCGGGAGGCATTG No data
Right 1176400437 21:6309338-6309360 CAGAGGAAAAAGGAGCATGGAGG No data
1176400424_1176400437 24 Left 1176400424 21:6309291-6309313 CCAATGGTGACCTGAGAGTTGCG No data
Right 1176400437 21:6309338-6309360 CAGAGGAAAAAGGAGCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176400437 Original CRISPR CAGAGGAAAAAGGAGCATGG AGG Intergenic
No off target data available for this crispr