ID: 1176401715

View in Genome Browser
Species Human (GRCh38)
Location 21:6318732-6318754
Sequence GGTCCTCGCTGCTGGCCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176401715_1176401717 -7 Left 1176401715 21:6318732-6318754 CCGCTGGGCCAGCAGCGAGGACC No data
Right 1176401717 21:6318748-6318770 GAGGACCCCCACGTCCCGTCCGG No data
1176401715_1176401722 2 Left 1176401715 21:6318732-6318754 CCGCTGGGCCAGCAGCGAGGACC No data
Right 1176401722 21:6318757-6318779 CACGTCCCGTCCGGCCCATCCGG No data
1176401715_1176401727 15 Left 1176401715 21:6318732-6318754 CCGCTGGGCCAGCAGCGAGGACC No data
Right 1176401727 21:6318770-6318792 GCCCATCCGGTCCTGTCCCTGGG No data
1176401715_1176401726 14 Left 1176401715 21:6318732-6318754 CCGCTGGGCCAGCAGCGAGGACC No data
Right 1176401726 21:6318769-6318791 GGCCCATCCGGTCCTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176401715 Original CRISPR GGTCCTCGCTGCTGGCCCAG CGG (reversed) Intergenic