ID: 1176401716 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:6318740-6318762 |
Sequence | GACGTGGGGGTCCTCGCTGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1176401716_1176401727 | 7 | Left | 1176401716 | 21:6318740-6318762 | CCAGCAGCGAGGACCCCCACGTC | No data | ||
Right | 1176401727 | 21:6318770-6318792 | GCCCATCCGGTCCTGTCCCTGGG | No data | ||||
1176401716_1176401722 | -6 | Left | 1176401716 | 21:6318740-6318762 | CCAGCAGCGAGGACCCCCACGTC | No data | ||
Right | 1176401722 | 21:6318757-6318779 | CACGTCCCGTCCGGCCCATCCGG | No data | ||||
1176401716_1176401726 | 6 | Left | 1176401716 | 21:6318740-6318762 | CCAGCAGCGAGGACCCCCACGTC | No data | ||
Right | 1176401726 | 21:6318769-6318791 | GGCCCATCCGGTCCTGTCCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1176401716 | Original CRISPR | GACGTGGGGGTCCTCGCTGC TGG (reversed) | Intergenic | ||