ID: 1176401716 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:6318740-6318762 |
| Sequence | GACGTGGGGGTCCTCGCTGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1176401716_1176401726 | 6 | Left | 1176401716 | 21:6318740-6318762 | CCAGCAGCGAGGACCCCCACGTC | No data | ||
| Right | 1176401726 | 21:6318769-6318791 | GGCCCATCCGGTCCTGTCCCTGG | 0: 7 1: 6 2: 0 3: 8 4: 132 |
||||
| 1176401716_1176401722 | -6 | Left | 1176401716 | 21:6318740-6318762 | CCAGCAGCGAGGACCCCCACGTC | No data | ||
| Right | 1176401722 | 21:6318757-6318779 | CACGTCCCGTCCGGCCCATCCGG | No data | ||||
| 1176401716_1176401727 | 7 | Left | 1176401716 | 21:6318740-6318762 | CCAGCAGCGAGGACCCCCACGTC | No data | ||
| Right | 1176401727 | 21:6318770-6318792 | GCCCATCCGGTCCTGTCCCTGGG | 0: 7 1: 6 2: 0 3: 7 4: 135 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1176401716 | Original CRISPR | GACGTGGGGGTCCTCGCTGC TGG (reversed) | Intergenic | ||