ID: 1176401717

View in Genome Browser
Species Human (GRCh38)
Location 21:6318748-6318770
Sequence GAGGACCCCCACGTCCCGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176401706_1176401717 21 Left 1176401706 21:6318704-6318726 CCCTCAGTCCCCTGTGGCTGCAA No data
Right 1176401717 21:6318748-6318770 GAGGACCCCCACGTCCCGTCCGG No data
1176401709_1176401717 13 Left 1176401709 21:6318712-6318734 CCCCTGTGGCTGCAAGATGGCCG No data
Right 1176401717 21:6318748-6318770 GAGGACCCCCACGTCCCGTCCGG No data
1176401715_1176401717 -7 Left 1176401715 21:6318732-6318754 CCGCTGGGCCAGCAGCGAGGACC No data
Right 1176401717 21:6318748-6318770 GAGGACCCCCACGTCCCGTCCGG No data
1176401710_1176401717 12 Left 1176401710 21:6318713-6318735 CCCTGTGGCTGCAAGATGGCCGC No data
Right 1176401717 21:6318748-6318770 GAGGACCCCCACGTCCCGTCCGG No data
1176401711_1176401717 11 Left 1176401711 21:6318714-6318736 CCTGTGGCTGCAAGATGGCCGCT No data
Right 1176401717 21:6318748-6318770 GAGGACCCCCACGTCCCGTCCGG No data
1176401707_1176401717 20 Left 1176401707 21:6318705-6318727 CCTCAGTCCCCTGTGGCTGCAAG No data
Right 1176401717 21:6318748-6318770 GAGGACCCCCACGTCCCGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176401717 Original CRISPR GAGGACCCCCACGTCCCGTC CGG Intergenic