ID: 1176401718

View in Genome Browser
Species Human (GRCh38)
Location 21:6318753-6318775
Sequence ATGGGCCGGACGGGACGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176401718_1176401726 -7 Left 1176401718 21:6318753-6318775 CCCCCACGTCCCGTCCGGCCCAT No data
Right 1176401726 21:6318769-6318791 GGCCCATCCGGTCCTGTCCCTGG No data
1176401718_1176401727 -6 Left 1176401718 21:6318753-6318775 CCCCCACGTCCCGTCCGGCCCAT No data
Right 1176401727 21:6318770-6318792 GCCCATCCGGTCCTGTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176401718 Original CRISPR ATGGGCCGGACGGGACGTGG GGG (reversed) Intergenic