ID: 1176401719

View in Genome Browser
Species Human (GRCh38)
Location 21:6318754-6318776
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176401719_1176401727 -7 Left 1176401719 21:6318754-6318776 CCCCACGTCCCGTCCGGCCCATC No data
Right 1176401727 21:6318770-6318792 GCCCATCCGGTCCTGTCCCTGGG No data
1176401719_1176401726 -8 Left 1176401719 21:6318754-6318776 CCCCACGTCCCGTCCGGCCCATC No data
Right 1176401726 21:6318769-6318791 GGCCCATCCGGTCCTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176401719 Original CRISPR GATGGGCCGGACGGGACGTG GGG (reversed) Intergenic