ID: 1176401727

View in Genome Browser
Species Human (GRCh38)
Location 21:6318770-6318792
Sequence GCCCATCCGGTCCTGTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176401718_1176401727 -6 Left 1176401718 21:6318753-6318775 CCCCCACGTCCCGTCCGGCCCAT No data
Right 1176401727 21:6318770-6318792 GCCCATCCGGTCCTGTCCCTGGG No data
1176401716_1176401727 7 Left 1176401716 21:6318740-6318762 CCAGCAGCGAGGACCCCCACGTC No data
Right 1176401727 21:6318770-6318792 GCCCATCCGGTCCTGTCCCTGGG No data
1176401721_1176401727 -9 Left 1176401721 21:6318756-6318778 CCACGTCCCGTCCGGCCCATCCG No data
Right 1176401727 21:6318770-6318792 GCCCATCCGGTCCTGTCCCTGGG No data
1176401720_1176401727 -8 Left 1176401720 21:6318755-6318777 CCCACGTCCCGTCCGGCCCATCC No data
Right 1176401727 21:6318770-6318792 GCCCATCCGGTCCTGTCCCTGGG No data
1176401715_1176401727 15 Left 1176401715 21:6318732-6318754 CCGCTGGGCCAGCAGCGAGGACC No data
Right 1176401727 21:6318770-6318792 GCCCATCCGGTCCTGTCCCTGGG No data
1176401719_1176401727 -7 Left 1176401719 21:6318754-6318776 CCCCACGTCCCGTCCGGCCCATC No data
Right 1176401727 21:6318770-6318792 GCCCATCCGGTCCTGTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176401727 Original CRISPR GCCCATCCGGTCCTGTCCCT GGG Intergenic