ID: 1176406138

View in Genome Browser
Species Human (GRCh38)
Location 21:6368815-6368837
Sequence TCCCTGTGTTGGGGGAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176406138_1176406143 7 Left 1176406138 21:6368815-6368837 CCAACACTCCCCCAACACAGGGA No data
Right 1176406143 21:6368845-6368867 AACAAATTCCCTTTGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176406138 Original CRISPR TCCCTGTGTTGGGGGAGTGT TGG (reversed) Intergenic
No off target data available for this crispr