ID: 1176406359

View in Genome Browser
Species Human (GRCh38)
Location 21:6370416-6370438
Sequence TAGTCTAAGGAGAAAGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176406356_1176406359 -3 Left 1176406356 21:6370396-6370418 CCAGCTCAGTGACAGTGCGCTAG No data
Right 1176406359 21:6370416-6370438 TAGTCTAAGGAGAAAGAGGCCGG No data
1176406354_1176406359 9 Left 1176406354 21:6370384-6370406 CCTAGTATGCACCCAGCTCAGTG No data
Right 1176406359 21:6370416-6370438 TAGTCTAAGGAGAAAGAGGCCGG No data
1176406355_1176406359 -2 Left 1176406355 21:6370395-6370417 CCCAGCTCAGTGACAGTGCGCTA No data
Right 1176406359 21:6370416-6370438 TAGTCTAAGGAGAAAGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176406359 Original CRISPR TAGTCTAAGGAGAAAGAGGC CGG Intergenic
No off target data available for this crispr