ID: 1176406554

View in Genome Browser
Species Human (GRCh38)
Location 21:6371804-6371826
Sequence AGCCCGGTGATGAAAGGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176406554_1176406559 12 Left 1176406554 21:6371804-6371826 CCCAGACCTTTCATCACCGGGCT No data
Right 1176406559 21:6371839-6371861 TCCCAGCATGCACCCAGCTCAGG No data
1176406554_1176406565 30 Left 1176406554 21:6371804-6371826 CCCAGACCTTTCATCACCGGGCT No data
Right 1176406565 21:6371857-6371879 TCAGGGACAGTGCGCATTACTGG No data
1176406554_1176406561 13 Left 1176406554 21:6371804-6371826 CCCAGACCTTTCATCACCGGGCT No data
Right 1176406561 21:6371840-6371862 CCCAGCATGCACCCAGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176406554 Original CRISPR AGCCCGGTGATGAAAGGTCT GGG (reversed) Intergenic
No off target data available for this crispr