ID: 1176407848

View in Genome Browser
Species Human (GRCh38)
Location 21:6431179-6431201
Sequence GGCCATGCCCGTCGTGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176407841_1176407848 13 Left 1176407841 21:6431143-6431165 CCGGTTCTCTGTCATGTCACATT No data
Right 1176407848 21:6431179-6431201 GGCCATGCCCGTCGTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176407848 Original CRISPR GGCCATGCCCGTCGTGTGCT GGG Intergenic
No off target data available for this crispr