ID: 1176408814

View in Genome Browser
Species Human (GRCh38)
Location 21:6436743-6436765
Sequence AGCCTGAGACTGCTGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176408810_1176408814 3 Left 1176408810 21:6436717-6436739 CCTTGCAGACAGCCAGGGGAGGT No data
Right 1176408814 21:6436743-6436765 AGCCTGAGACTGCTGCAGCAGGG No data
1176408808_1176408814 4 Left 1176408808 21:6436716-6436738 CCCTTGCAGACAGCCAGGGGAGG No data
Right 1176408814 21:6436743-6436765 AGCCTGAGACTGCTGCAGCAGGG No data
1176408812_1176408814 -9 Left 1176408812 21:6436729-6436751 CCAGGGGAGGTGGCAGCCTGAGA No data
Right 1176408814 21:6436743-6436765 AGCCTGAGACTGCTGCAGCAGGG No data
1176408804_1176408814 26 Left 1176408804 21:6436694-6436716 CCGATTGTGACGGAGCGTGAGAC No data
Right 1176408814 21:6436743-6436765 AGCCTGAGACTGCTGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176408814 Original CRISPR AGCCTGAGACTGCTGCAGCA GGG Intergenic
No off target data available for this crispr