ID: 1176409001

View in Genome Browser
Species Human (GRCh38)
Location 21:6437602-6437624
Sequence GGGGGAGGACACTGGCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176409001_1176409013 8 Left 1176409001 21:6437602-6437624 CCTCCCTGCCAGTGTCCTCCCCC No data
Right 1176409013 21:6437633-6437655 TGCAGGAACAACACCGTCATGGG No data
1176409001_1176409017 22 Left 1176409001 21:6437602-6437624 CCTCCCTGCCAGTGTCCTCCCCC No data
Right 1176409017 21:6437647-6437669 CGTCATGGGGGCCCGAGAGTTGG No data
1176409001_1176409012 7 Left 1176409001 21:6437602-6437624 CCTCCCTGCCAGTGTCCTCCCCC No data
Right 1176409012 21:6437632-6437654 CTGCAGGAACAACACCGTCATGG No data
1176409001_1176409018 23 Left 1176409001 21:6437602-6437624 CCTCCCTGCCAGTGTCCTCCCCC No data
Right 1176409018 21:6437648-6437670 GTCATGGGGGCCCGAGAGTTGGG No data
1176409001_1176409005 -9 Left 1176409001 21:6437602-6437624 CCTCCCTGCCAGTGTCCTCCCCC No data
Right 1176409005 21:6437616-6437638 TCCTCCCCCAGCAGACCTGCAGG No data
1176409001_1176409014 9 Left 1176409001 21:6437602-6437624 CCTCCCTGCCAGTGTCCTCCCCC No data
Right 1176409014 21:6437634-6437656 GCAGGAACAACACCGTCATGGGG No data
1176409001_1176409015 10 Left 1176409001 21:6437602-6437624 CCTCCCTGCCAGTGTCCTCCCCC No data
Right 1176409015 21:6437635-6437657 CAGGAACAACACCGTCATGGGGG No data
1176409001_1176409019 24 Left 1176409001 21:6437602-6437624 CCTCCCTGCCAGTGTCCTCCCCC No data
Right 1176409019 21:6437649-6437671 TCATGGGGGCCCGAGAGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176409001 Original CRISPR GGGGGAGGACACTGGCAGGG AGG (reversed) Intergenic
No off target data available for this crispr