ID: 1176411141

View in Genome Browser
Species Human (GRCh38)
Location 21:6450240-6450262
Sequence CTGGGCCCACCTGGAGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176411141_1176411148 -4 Left 1176411141 21:6450240-6450262 CCCTGACCTCCAGGTGGGCCCAG No data
Right 1176411148 21:6450259-6450281 CCAGGACAGCCTGCACACAAAGG No data
1176411141_1176411154 5 Left 1176411141 21:6450240-6450262 CCCTGACCTCCAGGTGGGCCCAG No data
Right 1176411154 21:6450268-6450290 CCTGCACACAAAGGGTGGGTGGG No data
1176411141_1176411152 4 Left 1176411141 21:6450240-6450262 CCCTGACCTCCAGGTGGGCCCAG No data
Right 1176411152 21:6450267-6450289 GCCTGCACACAAAGGGTGGGTGG No data
1176411141_1176411149 -3 Left 1176411141 21:6450240-6450262 CCCTGACCTCCAGGTGGGCCCAG No data
Right 1176411149 21:6450260-6450282 CAGGACAGCCTGCACACAAAGGG No data
1176411141_1176411157 19 Left 1176411141 21:6450240-6450262 CCCTGACCTCCAGGTGGGCCCAG No data
Right 1176411157 21:6450282-6450304 GTGGGTGGGCTGAGGTCTGAGGG No data
1176411141_1176411156 18 Left 1176411141 21:6450240-6450262 CCCTGACCTCCAGGTGGGCCCAG No data
Right 1176411156 21:6450281-6450303 GGTGGGTGGGCTGAGGTCTGAGG No data
1176411141_1176411155 11 Left 1176411141 21:6450240-6450262 CCCTGACCTCCAGGTGGGCCCAG No data
Right 1176411155 21:6450274-6450296 CACAAAGGGTGGGTGGGCTGAGG No data
1176411141_1176411158 24 Left 1176411141 21:6450240-6450262 CCCTGACCTCCAGGTGGGCCCAG No data
Right 1176411158 21:6450287-6450309 TGGGCTGAGGTCTGAGGGCCTGG No data
1176411141_1176411151 1 Left 1176411141 21:6450240-6450262 CCCTGACCTCCAGGTGGGCCCAG No data
Right 1176411151 21:6450264-6450286 ACAGCCTGCACACAAAGGGTGGG No data
1176411141_1176411150 0 Left 1176411141 21:6450240-6450262 CCCTGACCTCCAGGTGGGCCCAG No data
Right 1176411150 21:6450263-6450285 GACAGCCTGCACACAAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176411141 Original CRISPR CTGGGCCCACCTGGAGGTCA GGG (reversed) Intergenic