ID: 1176411266

View in Genome Browser
Species Human (GRCh38)
Location 21:6450737-6450759
Sequence CAGTGTGACAGGCAGGAGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176411266_1176411276 2 Left 1176411266 21:6450737-6450759 CCGCTCTCCTGCCTGTCACACTG No data
Right 1176411276 21:6450762-6450784 CAGGGCCAGCACAGGCCACGGGG No data
1176411266_1176411275 1 Left 1176411266 21:6450737-6450759 CCGCTCTCCTGCCTGTCACACTG No data
Right 1176411275 21:6450761-6450783 GCAGGGCCAGCACAGGCCACGGG No data
1176411266_1176411273 -6 Left 1176411266 21:6450737-6450759 CCGCTCTCCTGCCTGTCACACTG No data
Right 1176411273 21:6450754-6450776 ACACTGGGCAGGGCCAGCACAGG No data
1176411266_1176411274 0 Left 1176411266 21:6450737-6450759 CCGCTCTCCTGCCTGTCACACTG No data
Right 1176411274 21:6450760-6450782 GGCAGGGCCAGCACAGGCCACGG No data
1176411266_1176411281 28 Left 1176411266 21:6450737-6450759 CCGCTCTCCTGCCTGTCACACTG No data
Right 1176411281 21:6450788-6450810 GCTCTCCTGCCTGTCACACTGGG No data
1176411266_1176411280 27 Left 1176411266 21:6450737-6450759 CCGCTCTCCTGCCTGTCACACTG No data
Right 1176411280 21:6450787-6450809 CGCTCTCCTGCCTGTCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176411266 Original CRISPR CAGTGTGACAGGCAGGAGAG CGG (reversed) Intergenic
No off target data available for this crispr