ID: 1176412205

View in Genome Browser
Species Human (GRCh38)
Location 21:6455153-6455175
Sequence AACGCCCTTGTCTCATCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 2, 1: 0, 2: 1, 3: 5, 4: 58}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176412205 Original CRISPR AACGCCCTTGTCTCATCAGC GGG Intergenic
909435734 1:75639843-75639865 TACCCCCTTATCTCATCATCTGG - Intergenic
918046400 1:180944182-180944204 AACTCCCTTGACTCCTCAGATGG + Intronic
920353894 1:205356364-205356386 AAGGGCCTTTTCTCCTCAGCTGG - Intronic
923079112 1:230636985-230637007 AACTCCCTTGTATCTCCAGCAGG - Intergenic
1067734531 10:48838928-48838950 AAGACCCTCCTCTCATCAGCAGG - Intronic
1070039105 10:72757288-72757310 ATCTCCCTTGTTTCTTCAGCTGG - Intronic
1070648270 10:78216339-78216361 AACCTCCTTGTCTCCTGAGCTGG - Intergenic
1079898528 11:26151463-26151485 AACTCCCTTAGCTCACCAGCTGG - Intergenic
1093215815 12:16360080-16360102 AAAGCCAGTGTCTCATCACCAGG - Intronic
1109998299 13:70159415-70159437 GACACTCTTGTCTCATTAGCAGG + Intergenic
1112637163 13:101227673-101227695 AAACCCCATGTCTCATCTGCTGG + Intronic
1114069661 14:19097292-19097314 AAAGCCCCTGTCTCATATGCTGG - Intergenic
1120350867 14:83356458-83356480 AACCCCCTTGTTTCATCTGAAGG - Intergenic
1125089007 15:35769090-35769112 TACTCCTTTGACTCATCAGCAGG + Intergenic
1127559581 15:60122600-60122622 AAAGGCCTTGCCTCATCAACAGG - Intergenic
1130681561 15:86001497-86001519 AAAGAGTTTGTCTCATCAGCAGG + Intergenic
1130890682 15:88131500-88131522 AACACCCTCTTCTCAACAGCAGG + Intronic
1131688135 15:94793455-94793477 AACACCCTGGTTTTATCAGCTGG - Intergenic
1139901757 16:70333622-70333644 AACGCACTTGTCTCCTGTGCAGG - Exonic
1141644526 16:85360187-85360209 AAGAACCTTGTCTCATCAGCAGG + Intergenic
1146105917 17:30036887-30036909 AACCTCCTTCTCTCTTCAGCTGG - Intronic
1148816196 17:50329864-50329886 CACGCCCTGGCCTCACCAGCTGG + Intergenic
1149564201 17:57629972-57629994 AAGGCCCCTGTCTCATCAGAGGG + Intronic
1150658667 17:67057007-67057029 AACACCCTTGCTTCATCAGAGGG - Intergenic
1151426687 17:74035281-74035303 AAGCCCCATGTCTCATCTGCTGG + Intergenic
1152589967 17:81206801-81206823 AGTGCCCTTGACTCACCAGCGGG - Exonic
1157633731 18:49128278-49128300 TACGCACTTGTCTCTTCTGCTGG - Intronic
928418750 2:31121057-31121079 CAGGCCCTGGTCACATCAGCAGG + Intronic
931091202 2:58888437-58888459 AATGCCCTTCTCACATCACCTGG + Intergenic
932622121 2:73270888-73270910 AACTGGCTTGTCTGATCAGCAGG - Intronic
935476713 2:103531328-103531350 GACAGCCTTGTCTCAGCAGCAGG - Intergenic
943455540 2:188102916-188102938 ACTGCACCTGTCTCATCAGCAGG - Intergenic
1169394163 20:5215026-5215048 AATGCCCTGGTCTCCTCAGCAGG - Intergenic
1170069423 20:12348834-12348856 CATGCCCCTCTCTCATCAGCTGG + Intergenic
1171212546 20:23327919-23327941 AACACCCTTGTCTCCCCAGACGG + Intergenic
1174280021 20:49432600-49432622 CACGCCTGTGTCCCATCAGCTGG - Intronic
1176412205 21:6455153-6455175 AACGCCCTTGTCTCATCAGCGGG + Intergenic
1179687699 21:43063475-43063497 AACGCCCTTGTCTCATCAGCGGG + Intronic
953463137 3:43097287-43097309 CCCGCCATTCTCTCATCAGCTGG - Intronic
961238179 3:125386622-125386644 AAGGCCGTGGTCTCATCTGCAGG + Intergenic
973643362 4:52925645-52925667 AAGGCCGTTATCTCATAAGCTGG - Intronic
978660525 4:111120795-111120817 ATCACCCCTGTCTCCTCAGCTGG - Intergenic
985871692 5:2562585-2562607 AACACCCCTGTCCCATCAACTGG - Intergenic
994088281 5:95783778-95783800 ATGTCCCTTTTCTCATCAGCTGG + Exonic
996704962 5:126488288-126488310 ATTGCCCTTGTCTCATAATCAGG - Intronic
999707475 5:154286745-154286767 AACTCCATTGTCTCAACACCAGG - Intronic
1001184079 5:169550643-169550665 AACCCCCTTGTCTCATGAGCAGG + Intergenic
1002564160 5:180100546-180100568 AACCCCCTTGGCCCACCAGCAGG - Intergenic
1017949026 6:159119894-159119916 AACTCCCCTGTTTCCTCAGCGGG + Intergenic
1020454953 7:8361294-8361316 GACACCCTTTTCTGATCAGCTGG + Intergenic
1023661842 7:42478304-42478326 AAAGCCCATGTCTCATTGGCTGG + Intergenic
1027175653 7:75901531-75901553 AAACCCCATGTCTCATCTGCTGG - Intronic
1029306154 7:99621541-99621563 AAGGCCCGTGTCTCATCTCCAGG - Exonic
1041096621 8:54356527-54356549 AATGCCCTTCTCTTTTCAGCTGG - Intergenic
1041765395 8:61413400-61413422 AAACCCCATGTCTCATTAGCTGG - Intronic
1048358247 8:133671732-133671754 AAACCCCTTGTCTCATTTGCTGG - Intergenic
1048637545 8:136313979-136314001 ATCACCCTTCTCTCATCAGCTGG - Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1054996788 9:71400466-71400488 AACCCTCTTCTCTCATCAACTGG + Intronic
1059880843 9:118687195-118687217 AATGCCTTTGTCTCAGCAGCAGG - Intergenic
1185525328 X:773991-774013 AGTCCCCCTGTCTCATCAGCTGG + Intergenic
1186633480 X:11376841-11376863 GCCCCCCTTGTCTCATCAGGAGG - Intronic
1188108829 X:26173620-26173642 AATGCCCTTGTCCTTTCAGCAGG + Intergenic
1189991274 X:46597467-46597489 AAAGCCCTGTTCTCCTCAGCAGG + Intronic
1192213453 X:69142225-69142247 AACTCCTTTGTCCCCTCAGCTGG + Intergenic
1199527381 X:148807536-148807558 AACCCTTTTGACTCATCAGCAGG + Intronic