ID: 1176413544

View in Genome Browser
Species Human (GRCh38)
Location 21:6461734-6461756
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 2, 1: 0, 2: 0, 3: 20, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176413538_1176413544 20 Left 1176413538 21:6461691-6461713 CCAGAGCGCTTAGCAAGAAAAAG 0: 2
1: 0
2: 0
3: 13
4: 127
Right 1176413544 21:6461734-6461756 CCCTGGAGCCCCTTATCTCAAGG 0: 2
1: 0
2: 0
3: 20
4: 209
1176413536_1176413544 26 Left 1176413536 21:6461685-6461707 CCAGGCCCAGAGCGCTTAGCAAG 0: 2
1: 0
2: 0
3: 17
4: 149
Right 1176413544 21:6461734-6461756 CCCTGGAGCCCCTTATCTCAAGG 0: 2
1: 0
2: 0
3: 20
4: 209
1176413537_1176413544 21 Left 1176413537 21:6461690-6461712 CCCAGAGCGCTTAGCAAGAAAAA 0: 2
1: 0
2: 2
3: 3
4: 120
Right 1176413544 21:6461734-6461756 CCCTGGAGCCCCTTATCTCAAGG 0: 2
1: 0
2: 0
3: 20
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176413544 Original CRISPR CCCTGGAGCCCCTTATCTCA AGG Intergenic
900391113 1:2434361-2434383 CCGTGGGGCCCCTTCTCTCCCGG + Intronic
900934336 1:5755808-5755830 CCCTGGAGCTCCTGCTGTCAGGG - Intergenic
900978373 1:6031803-6031825 CCCTTGAGCCCCATAGGTCAGGG + Intronic
901454207 1:9353983-9354005 GCCCCGACCCCCTTATCTCAGGG - Intronic
902640214 1:17762227-17762249 CCCCGGAGCCCTATATCTGAAGG - Intronic
902818269 1:18928249-18928271 CCATGGAGCCCCTGATCCCAAGG + Intronic
904337647 1:29808583-29808605 CTCTGGAGCCCTTTCTCTAAGGG + Intergenic
905482710 1:38272360-38272382 CCCTGGAGCACTCTGTCTCAGGG - Intergenic
906152620 1:43596345-43596367 CCCCAGAGCCCCTCATCTCCAGG - Intronic
906205444 1:43984111-43984133 CCCTGCAGCCCCAATTCTCAGGG + Intronic
907764030 1:57390483-57390505 ACCTGGAGCTCCTTAATTCATGG + Intronic
908662585 1:66452882-66452904 CTTTGGAGCCCCTCATCACATGG - Intergenic
910673988 1:89799321-89799343 CCCTGAAGCCCCTGTTCTCAAGG - Intronic
912565159 1:110582284-110582306 TCCTGGACCACCTTAGCTCAAGG - Intergenic
915068825 1:153248575-153248597 CCTTGGAGCCCCTCATCCTAGGG - Intergenic
917024791 1:170630738-170630760 CTCTGGAACCTCTGATCTCAAGG + Intergenic
917633037 1:176908527-176908549 ACCTGGAATTCCTTATCTCATGG + Intronic
918048685 1:180956163-180956185 CCCCGCAGCCCCTTTCCTCAGGG - Intergenic
919840870 1:201608677-201608699 CCCTGGAGCCTCACAGCTCATGG + Intergenic
922718202 1:227887619-227887641 CCCTGGAGGCCCTAAGCTCAGGG - Intergenic
1062794003 10:329014-329036 CCCTGGAGACCCTGATTTCTGGG - Intronic
1063393943 10:5669199-5669221 CCCTGGAGCCCAGAATCTCCAGG - Intergenic
1066985912 10:42466399-42466421 TTCTGGAGCCCCTTATCAGACGG + Intergenic
1067501194 10:46806599-46806621 TTCTGGAGCCCCTTATCAGATGG - Intergenic
1067593385 10:47533316-47533338 TTCTGGAGCCCCTTATCAGATGG + Intronic
1067640495 10:48041420-48041442 TTCTGGAGCCCCTTATCAGATGG + Intergenic
1070137451 10:73707451-73707473 TTCTGGAGCCCCTTATCAGACGG + Intergenic
1071520912 10:86331024-86331046 CCCTGGTGGCCCTTCTCTCATGG - Intronic
1072298959 10:94040564-94040586 CCCTTGTGCACCTTCTCTCAGGG + Intronic
1072362572 10:94674195-94674217 CTCTGGAGCCTCTTTTATCAGGG - Intergenic
1074906390 10:117867855-117867877 CCCTACAGCCCCTTCTCTCTGGG - Intergenic
1077280334 11:1741871-1741893 CCCTGGGGCCCCTTTTATAAGGG - Intronic
1078508673 11:11969526-11969548 CCCTGAACCCCCTTGGCTCAAGG - Intronic
1079467012 11:20740527-20740549 CCCTGGAGTCCCTTAGATCTAGG + Intronic
1081197500 11:40179086-40179108 CCCTGGAGCCCAGGAGCTCAAGG - Intronic
1082758474 11:57102287-57102309 CCCTTGAGCCCCTGAGTTCATGG + Intergenic
1083322495 11:61856182-61856204 CCCTGGAGCCCTTAATTCCATGG - Intronic
1083860865 11:65419267-65419289 CCCTGAGGCCCCTCAGCTCAGGG - Intergenic
1083909006 11:65694456-65694478 CCCTGGAGCCTCTAAGCACATGG + Intergenic
1084319384 11:68365105-68365127 CCCAGGAGCCCATTGTCTCTGGG + Intronic
1085015959 11:73174167-73174189 CCCAGGAGGGCCTTATCTCCTGG + Intergenic
1085050436 11:73377390-73377412 TCCTGGAGACCCTTGTCTCCTGG - Intronic
1086197622 11:84160008-84160030 CCCTGCAGTCCCTCTTCTCAGGG - Intronic
1089147035 11:116336616-116336638 CCATGGAGCCATTTATCTCCTGG + Intergenic
1090374554 11:126279790-126279812 CCCTGGTGCTCCTCATCTCTGGG - Intergenic
1091318769 11:134635056-134635078 CCCTGTAACCCCTTCCCTCAAGG - Intergenic
1091753735 12:3038587-3038609 CCCTGGAGACCCTGCTCTAATGG + Intronic
1094855908 12:34402724-34402746 CCGTGGAGCGCCTTGGCTCACGG + Intergenic
1096839112 12:54370114-54370136 TCCTGGAACCCCGTATCTCGGGG + Exonic
1097690949 12:62734082-62734104 CCCTGGAGCCTCTTTTATAAGGG - Intronic
1098101099 12:67018112-67018134 CCCTGGCTCCCTGTATCTCAGGG + Intergenic
1104725889 12:131075497-131075519 CCCTGCCGCCCCGTATCTTAGGG - Intronic
1104963702 12:132499753-132499775 CCCCAGAGCACCTGATCTCACGG - Intronic
1104986457 12:132600345-132600367 ACCTGGAGCCTCTTATTACAAGG + Intergenic
1106946230 13:34830749-34830771 CCCAGCAGACCCTTGTCTCATGG - Intergenic
1107012692 13:35683917-35683939 CCCTGGAGCCTCCTTTCTCCTGG - Intergenic
1107348421 13:39488117-39488139 CCCTGGAGCCTCTTTTATAAGGG - Intronic
1107987943 13:45792000-45792022 CCCTTTAGCTCCTCATCTCATGG - Intronic
1107995305 13:45853373-45853395 CCCTGGAGCCACTTGTTACATGG + Intergenic
1109394268 13:61734650-61734672 CCCTGGAGCCTCTTTTTTAAAGG - Intergenic
1110701625 13:78555246-78555268 CCCTTGAGCCCAGTAGCTCAAGG + Intergenic
1113347560 13:109494916-109494938 CCCTGCTGCCCCTCATCTCTCGG + Intergenic
1114269123 14:21090721-21090743 CACTGGAGCCCCAGAGCTCATGG - Exonic
1116568606 14:46485644-46485666 AACTGGAGGCCATTATCTCAAGG - Intergenic
1116779861 14:49225111-49225133 GCTTGGAGCCCCTGACCTCAAGG + Intergenic
1117133318 14:52707229-52707251 TCCTGAAGCGCCTTATCTCTAGG - Exonic
1122413486 14:101537739-101537761 CTCTGGCGCTCCTCATCTCATGG - Intergenic
1122476156 14:102010829-102010851 CCCTGGAGTCCAGTATCACAGGG + Exonic
1124706764 15:31973039-31973061 CCCTGGGGCCCCTTATATAAGGG + Intergenic
1126676060 15:51160168-51160190 CCCTGGACCTCCTTTTCCCATGG + Intergenic
1130090971 15:80821129-80821151 CCTTGGAGCACATAATCTCACGG + Intronic
1131354666 15:91734321-91734343 CCCTGGGGTCCCTTACATCATGG + Intergenic
1131393438 15:92067958-92067980 CCCTGGAGCCTCTTTTTTAAGGG + Intronic
1132674667 16:1116768-1116790 GCCTGGAGCCACTTAGCTGATGG + Intergenic
1132686138 16:1162907-1162929 CCCTGGAACGCCTCTTCTCACGG + Intronic
1132785559 16:1655446-1655468 ACCTGGAGCCCCTTATTCCCTGG + Intronic
1133035705 16:3032981-3033003 CCCTGGAGCCCGTTCTCTAAGGG - Intronic
1133912623 16:10079564-10079586 CTCTGGAGCCTCTTTTATCAGGG - Intronic
1134062113 16:11205603-11205625 CCCTGGAGCCCTGGACCTCATGG - Intergenic
1138236116 16:55384191-55384213 GCCTGGATCCCCATATCTGATGG + Intergenic
1139509560 16:67419293-67419315 CCCTGGATCCACTTGACTCAGGG + Intergenic
1140478211 16:75249468-75249490 CCCTGCAGCCCTTTATCTGGGGG + Intronic
1140519402 16:75568334-75568356 TCCTGGAGCCCCTGATGTCAGGG - Intronic
1143713032 17:8746585-8746607 CCCTGGACCACCTGATTTCACGG - Intergenic
1143738213 17:8929672-8929694 AGCTGGAGGCCATTATCTCAAGG + Intronic
1144234571 17:13245370-13245392 CCCTGGAGACCCTTGTCCCAAGG + Intergenic
1148048942 17:44759783-44759805 CCCAGGAGCCCCTGAGGTCACGG + Exonic
1148703265 17:49604876-49604898 CCCTGGAATCCTTTTTCTCAAGG - Intronic
1150997663 17:70337662-70337684 CACTCGAGCCCCAAATCTCAAGG - Intergenic
1151532834 17:74718076-74718098 GTCTGGAGCTCCTGATCTCAAGG - Intronic
1151541938 17:74768996-74769018 CCCTGGACCCATTTATCACATGG - Exonic
1154337213 18:13475306-13475328 CCCTGGAGCCCAGGAGCTCAAGG + Intronic
1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG + Intronic
1157736976 18:50058384-50058406 CCCTGGAGCCCAGAAGCTCAAGG + Intronic
1158570745 18:58595302-58595324 TACTGGAGTCCCTGATCTCATGG - Intronic
1159219402 18:65440063-65440085 ACCTGGCTCACCTTATCTCAGGG - Intergenic
1159878366 18:73834555-73834577 CCCTGGAGACCTTTATCACCTGG - Intergenic
1159983433 18:74813602-74813624 CACTGGAGCCCTTCATCTTAGGG + Intronic
1160805517 19:990775-990797 CCCTGGTGCCCCTGTTCCCATGG + Intronic
1160862220 19:1242181-1242203 CCCAGGAGACGCTTATCTCGGGG - Intronic
1163326878 19:16610174-16610196 CCCTTGAGCCCAGTAGCTCAAGG + Intronic
1163690581 19:18736281-18736303 CCCTGCAGCCCCATAACTCGGGG - Intronic
1165363673 19:35351462-35351484 CCCAGGAGCCCCTCCTCTCCGGG + Intergenic
1165365806 19:35363910-35363932 CCCAGGAGCCCCTCCTCTCTGGG + Intergenic
1165838954 19:38775410-38775432 CCCTGCAGCCTCTGATCTCCTGG - Intergenic
925837672 2:7961674-7961696 CACTGGAACCCCTTATTTCAAGG - Intergenic
926302007 2:11611394-11611416 CCCTGGAGCCCAGGAGCTCAAGG - Intronic
926340655 2:11901994-11902016 TCCTGGATCCCCTTATCTAACGG + Intergenic
926355014 2:12033798-12033820 CCCTGATGCTCCTTAGCTCATGG - Intergenic
926516282 2:13850823-13850845 ACCCAGAGCCCTTTATCTCATGG - Intergenic
926898150 2:17717908-17717930 CACTGTAGCCTCTTATCTCCTGG - Intronic
927246256 2:20959202-20959224 CCCTGGGCATCCTTATCTCAGGG + Intergenic
931150204 2:59564743-59564765 CCCTGGAGCCCACTATCCAATGG + Intergenic
931448439 2:62347084-62347106 CCGTGAAGGCCCTTATTTCAGGG - Intergenic
931984963 2:67732808-67732830 CCTGAGAGCCCCTGATCTCATGG - Intergenic
932389387 2:71372266-71372288 CCCTGGAGCACTTTAGCCCATGG + Intronic
932798096 2:74715390-74715412 CCCTGGAGCCCCGCGGCTCAGGG + Intergenic
936913202 2:117613728-117613750 CCCTGGACACAATTATCTCAGGG + Intergenic
937061798 2:118985542-118985564 CCCTGCAGAACCTTCTCTCAGGG + Intronic
937261447 2:120588879-120588901 ACCTGATGCCCCTTATCTCTTGG - Intergenic
938089140 2:128419381-128419403 CCCAGGAGCCCCTCACCTCCCGG + Intergenic
939258121 2:139771446-139771468 CCCTGCAGCCTTTGATCTCATGG - Intergenic
941035046 2:160559312-160559334 TCCTGGAGCCCCTGAGTTCAAGG + Intergenic
948781491 2:240324371-240324393 CCCGGGAGCCGCCTCTCTCACGG - Intergenic
1169912684 20:10660157-10660179 CCCAGGAGTCCCTTCTCTCCTGG - Intronic
1171108598 20:22459539-22459561 CCCTTGAGCCCACGATCTCAAGG + Intergenic
1174367796 20:50066968-50066990 TCCTTGAGCCCCTGATCTGAGGG + Intergenic
1175335248 20:58191746-58191768 CCCTGGAGCCCCTAAACCCAGGG + Intergenic
1175499308 20:59438532-59438554 CACGGGAGCCCCTAATCTCCAGG - Intergenic
1176157578 20:63629645-63629667 CACTTGAGCCCCTTGTCTCGTGG + Intergenic
1176413544 21:6461734-6461756 CCCTGGAGCCCCTTATCTCAAGG + Intergenic
1176414317 21:6466387-6466409 CCCTGGAGCCCTCTCTCGCAAGG + Intergenic
1176994880 21:15543821-15543843 CCCCAGAGCCCCTTAGCCCATGG - Intergenic
1179689041 21:43070057-43070079 CCCTGGAGCCCCTTATCTCAAGG + Intronic
1179689815 21:43074709-43074731 CCCTGGAGCCCTCTCTCGCAAGG + Intronic
1179817753 21:43918348-43918370 CCCTGGAGCTCCTGAGCACATGG + Intronic
1180076547 21:45466163-45466185 CCCTTGGGTCCCTTATCTTAGGG - Intronic
1180182683 21:46124899-46124921 CCCTGGAGACCCCGGTCTCACGG + Exonic
1181115750 22:20631816-20631838 CCCTGGAGCCCCTTCACCCCTGG + Intergenic
1184278053 22:43421508-43421530 CCCTGGAACCCCTTTTCACAAGG + Intronic
1184349588 22:43934947-43934969 CCCAGGGTCCCCTTATCTGAAGG + Intronic
951476927 3:23117072-23117094 CCCTGGGACCCCTTACCTCCTGG - Intergenic
951972565 3:28463756-28463778 CCCTTGAACCCCTGAGCTCAAGG - Intronic
952826704 3:37530501-37530523 CCCTGGGGCCACCTATCTCCAGG - Intronic
952874881 3:37936253-37936275 CCCTGGGGACATTTATCTCATGG + Intronic
952977516 3:38708841-38708863 CCATGTAGCCCCTTTTCTCTCGG + Intronic
953120050 3:40031228-40031250 CCCTGGAGTCCCATATATAATGG + Intronic
954136655 3:48585035-48585057 CCCTGGAGCCCCTGGCCTAAAGG - Exonic
954462214 3:50633779-50633801 CTCTGCTGTCCCTTATCTCATGG - Intronic
958868242 3:99526268-99526290 CCCTGGAGTCCCTTTTATAAGGG + Intergenic
959526889 3:107387642-107387664 CCCTAGCTCCCCTTATCTCTTGG + Intergenic
963059951 3:141217474-141217496 CTCTGGAGCCCCCTCTCACATGG + Intergenic
964961071 3:162427526-162427548 CCCTGGAGCACTTTAGGTCATGG - Intergenic
967336353 3:188348868-188348890 CCCCGGACCCCGCTATCTCAAGG - Intronic
967937103 3:194737994-194738016 ACCTAGAGCCCCTTTTCCCAGGG + Intergenic
968596508 4:1488847-1488869 CCCAGGAGCCTCTGTTCTCATGG - Intergenic
968844586 4:3033305-3033327 CCCTGGGGCCCCTTTTCTAATGG + Intronic
969517089 4:7653898-7653920 CCCTGGAGAACCTCATCTCCTGG + Intronic
972600793 4:40570586-40570608 GCCTGGAACCCCTGATCTAAAGG + Intronic
978526187 4:109668939-109668961 CCCTCATGCCCCTTGTCTCACGG + Intronic
979105619 4:116682896-116682918 CACTGTAGCCCCTTGTGTCAAGG - Intergenic
986548266 5:8923784-8923806 CCCCAGAGCCCTTTAGCTCATGG - Intergenic
986730074 5:10628831-10628853 CCCTGGTGCCCCTTGACCCACGG - Intronic
989375239 5:40754199-40754221 CTCTGCAGCCCCTGATCTCTAGG - Intronic
996395511 5:123009979-123010001 CCTGGGAGCTCCGTATCTCATGG - Intronic
996783772 5:127216235-127216257 CCCTGGATTGCCTTATCTCCAGG - Intergenic
998766275 5:145491319-145491341 CCCTTGGGCCTCTTATATCAGGG + Intronic
999028691 5:148264968-148264990 CCCTGAAGCCCATTTTATCATGG - Intergenic
1001444911 5:171775564-171775586 CCCTGAAGACCCTGATCTCCAGG + Intergenic
1001776821 5:174335126-174335148 CTCATCAGCCCCTTATCTCAGGG + Intergenic
1002345202 5:178543976-178543998 CCCTGGGGTCCCTTTTCTAAGGG + Intronic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1003310996 6:4969895-4969917 CCCTGGAGCCTCTTTTATAAGGG + Intergenic
1004057128 6:12150958-12150980 CTCGGGAGCCCCTTCTCTCAGGG + Intronic
1006441948 6:34058576-34058598 CCCTGAATCCCCTCCTCTCAGGG - Intronic
1007397500 6:41586048-41586070 CCCTGGAGGCCCTTCTCCCCTGG + Intronic
1007737096 6:43988365-43988387 CAGGGGAGCCCCTTATCTCCTGG - Intergenic
1007784606 6:44272432-44272454 CTCTGGAGGCCCTTATCCAAAGG + Intronic
1008229217 6:48963627-48963649 CTCTGGAGCACCTGATCTCTTGG + Intergenic
1011545903 6:88481040-88481062 GCCTGCAGCCCTTTCTCTCAAGG + Intergenic
1013636935 6:112038029-112038051 CCCTGGAGACGCTGATGTCATGG + Intergenic
1013690900 6:112641950-112641972 CCCTGCAGCCCCTTTTTTCATGG - Intergenic
1015599398 6:134897579-134897601 CCCTGGACCTCTTTATCTCAAGG - Intergenic
1015999684 6:139029601-139029623 CCCTGCAGCCCATCATCACACGG - Intronic
1018979061 6:168588420-168588442 AGCTGGAGCCCCTTTTCTAAAGG + Intronic
1019061540 6:169260959-169260981 CCCAAGAGCCCCTTATTTCCTGG + Intergenic
1022843068 7:34182917-34182939 CTCTGGAGCCCCTTTTATAAGGG - Intergenic
1023139040 7:37082851-37082873 CCCAGGAGCCCTTTATAACAAGG + Intronic
1023603466 7:41904432-41904454 CTCTGGAGTCCCTTTTATCAGGG - Intergenic
1023694459 7:42830375-42830397 CTCTGGAGCTCCTTGTCTGAGGG + Intergenic
1024550978 7:50562194-50562216 CCCTGCAGCCCCTGCACTCATGG - Intronic
1026546362 7:71326373-71326395 CCCTCGAGCCCAGTAGCTCAAGG + Intronic
1027685423 7:81274286-81274308 CCCCAGAGCCCTTTAGCTCATGG + Intergenic
1029376218 7:100178230-100178252 TCCTGGAGCCGCTTACCCCAGGG + Intronic
1033661458 7:143405917-143405939 CTCTGGAACCCCTTCTCTCAGGG - Intronic
1034313424 7:150110057-150110079 CCCTGGAGCCCCCTGTCCAAGGG - Intergenic
1034458575 7:151185851-151185873 CCCTTGAGCCCATGATCTGAGGG + Intronic
1034793437 7:153990607-153990629 CCCTGGAGCCCCCTGTCCAAGGG + Intronic
1034960367 7:155360897-155360919 CCCTGCAGCCCCTCCTTTCACGG - Intronic
1037649695 8:20825168-20825190 CCCTGGGGCCTCTTTTATCAGGG + Intergenic
1037736561 8:21571652-21571674 TCCTGGAGCCATGTATCTCATGG - Intergenic
1041165857 8:55091527-55091549 TCCTCCAGCCCCTTATCTAAGGG + Intergenic
1047415741 8:124663293-124663315 CCTTGGAGCCCCTTTGCTCAAGG + Intronic
1048574578 8:135680696-135680718 CCCTGGAGGCCCTGGTCCCACGG + Intergenic
1049209536 8:141379110-141379132 CCCTGGGGACCCTGATCTGAGGG + Intergenic
1049250189 8:141584071-141584093 CCCTGGGGTCCCTTTTATCAGGG - Intergenic
1049482647 8:142834385-142834407 CCCGGGAGCCCCTCCGCTCAGGG - Intronic
1049860416 8:144894427-144894449 CCCTGCAGCCCTTTATCCCTTGG + Intronic
1050076876 9:1874887-1874909 GCCTGGAGCTCCTGAACTCAAGG - Intergenic
1055606301 9:77974285-77974307 CCCTGGACCTCATTAGCTCATGG - Intronic
1055695758 9:78882444-78882466 CCTCGGAGCCCCTTATCTGGAGG + Intergenic
1056461403 9:86812892-86812914 CCCTGGAGCCCCCTGTCTGGTGG + Intergenic
1057474877 9:95390065-95390087 CTCTGGAGCTCCTGAGCTCAAGG - Intergenic
1057968638 9:99530655-99530677 TCCTGGAGCCCCTGATCTGCAGG - Intergenic
1185671040 X:1810368-1810390 CTCTGGGGTCCCTTTTCTCAGGG - Intergenic
1185733688 X:2481314-2481336 ACTTGGAGCCCCTTGTGTCATGG - Intronic
1185860796 X:3577420-3577442 CCCTGGAGCTCTTTTTCCCAAGG + Intergenic
1186410026 X:9338797-9338819 CGCTGGAGCTCTGTATCTCAGGG + Intergenic
1187088103 X:16063162-16063184 CCTTGGCGCCCCTTGTCTGAAGG + Intergenic
1187529128 X:20080682-20080704 CTCTGGAGCCCCTGCTCCCAGGG - Intronic
1188311343 X:28620449-28620471 CCCTCAAGCCCCTCATGTCAGGG + Intronic
1188992422 X:36838307-36838329 CCCTGGAGCCCCTTACTGCATGG + Intergenic
1190919654 X:54839903-54839925 CCCTGGAGCACTTTAGCTCATGG + Intergenic
1191864283 X:65691320-65691342 CCCAGAAGCCCCCTATCTCCTGG + Intronic
1192470257 X:71392261-71392283 CCCTTCAGCCCCTTATCCCTTGG - Intronic
1194019118 X:88665767-88665789 CCCAGGAGCCACTCATCTCCAGG - Intergenic
1194874675 X:99172071-99172093 GCCTGAAGCCCCAAATCTCAGGG + Intergenic
1196564412 X:117188549-117188571 CCCTAGAGCACTTTAGCTCATGG - Intergenic
1200060962 X:153483577-153483599 CCCTGGAGCCCCCTGCCTCCTGG - Intronic
1200804158 Y:7415184-7415206 CCCTGGAGCTCTTTTTCCCATGG - Intergenic
1200843079 Y:7803640-7803662 CCCTGGAGCCCCTTTTTCCCAGG + Intergenic