ID: 1176414671

View in Genome Browser
Species Human (GRCh38)
Location 21:6467683-6467705
Sequence GTCCCAGGCTGCGGCGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176414671_1176414684 10 Left 1176414671 21:6467683-6467705 CCCACCCCGCCGCAGCCTGGGAC No data
Right 1176414684 21:6467716-6467738 GCCCGACCCCCGCCCTCCCCGGG No data
1176414671_1176414689 17 Left 1176414671 21:6467683-6467705 CCCACCCCGCCGCAGCCTGGGAC No data
Right 1176414689 21:6467723-6467745 CCCCGCCCTCCCCGGGACCCCGG No data
1176414671_1176414683 9 Left 1176414671 21:6467683-6467705 CCCACCCCGCCGCAGCCTGGGAC No data
Right 1176414683 21:6467715-6467737 TGCCCGACCCCCGCCCTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176414671 Original CRISPR GTCCCAGGCTGCGGCGGGGT GGG (reversed) Intergenic
No off target data available for this crispr