ID: 1176416014

View in Genome Browser
Species Human (GRCh38)
Location 21:6475191-6475213
Sequence AAGCCAGGAGTGGCCCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176416014_1176416022 12 Left 1176416014 21:6475191-6475213 CCATGAGGGGCCACTCCTGGCTT No data
Right 1176416022 21:6475226-6475248 CCCCACCCCCCATCCTTCCCTGG No data
1176416014_1176416026 17 Left 1176416014 21:6475191-6475213 CCATGAGGGGCCACTCCTGGCTT No data
Right 1176416026 21:6475231-6475253 CCCCCCATCCTTCCCTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176416014 Original CRISPR AAGCCAGGAGTGGCCCCTCA TGG (reversed) Intergenic
No off target data available for this crispr