ID: 1176417005

View in Genome Browser
Species Human (GRCh38)
Location 21:6481976-6481998
Sequence CAGATTTTCTCCAATTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176417000_1176417005 4 Left 1176417000 21:6481949-6481971 CCCCATACTCAGTTCATTTGAAG No data
Right 1176417005 21:6481976-6481998 CAGATTTTCTCCAATTAGCAGGG No data
1176416997_1176417005 17 Left 1176416997 21:6481936-6481958 CCACCAATACCTTCCCCATACTC No data
Right 1176417005 21:6481976-6481998 CAGATTTTCTCCAATTAGCAGGG No data
1176416999_1176417005 8 Left 1176416999 21:6481945-6481967 CCTTCCCCATACTCAGTTCATTT No data
Right 1176417005 21:6481976-6481998 CAGATTTTCTCCAATTAGCAGGG No data
1176417003_1176417005 2 Left 1176417003 21:6481951-6481973 CCATACTCAGTTCATTTGAAGGC No data
Right 1176417005 21:6481976-6481998 CAGATTTTCTCCAATTAGCAGGG No data
1176416998_1176417005 14 Left 1176416998 21:6481939-6481961 CCAATACCTTCCCCATACTCAGT No data
Right 1176417005 21:6481976-6481998 CAGATTTTCTCCAATTAGCAGGG No data
1176416996_1176417005 28 Left 1176416996 21:6481925-6481947 CCGTGGGCACACCACCAATACCT No data
Right 1176417005 21:6481976-6481998 CAGATTTTCTCCAATTAGCAGGG No data
1176417001_1176417005 3 Left 1176417001 21:6481950-6481972 CCCATACTCAGTTCATTTGAAGG No data
Right 1176417005 21:6481976-6481998 CAGATTTTCTCCAATTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176417005 Original CRISPR CAGATTTTCTCCAATTAGCA GGG Intergenic
No off target data available for this crispr