ID: 1176417252

View in Genome Browser
Species Human (GRCh38)
Location 21:6483856-6483878
Sequence CCCTGCTCTGCTCCTTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176417252_1176417261 12 Left 1176417252 21:6483856-6483878 CCCCCACAAGGAGCAGAGCAGGG No data
Right 1176417261 21:6483891-6483913 GGTGACTCCCACCTAGAGCCAGG No data
1176417252_1176417262 15 Left 1176417252 21:6483856-6483878 CCCCCACAAGGAGCAGAGCAGGG No data
Right 1176417262 21:6483894-6483916 GACTCCCACCTAGAGCCAGGAGG No data
1176417252_1176417259 -9 Left 1176417252 21:6483856-6483878 CCCCCACAAGGAGCAGAGCAGGG No data
Right 1176417259 21:6483870-6483892 AGAGCAGGGCAGGAGAGCCTGGG No data
1176417252_1176417258 -10 Left 1176417252 21:6483856-6483878 CCCCCACAAGGAGCAGAGCAGGG No data
Right 1176417258 21:6483869-6483891 CAGAGCAGGGCAGGAGAGCCTGG No data
1176417252_1176417268 30 Left 1176417252 21:6483856-6483878 CCCCCACAAGGAGCAGAGCAGGG No data
Right 1176417268 21:6483909-6483931 CCAGGAGGTTTTTGAGGATGAGG No data
1176417252_1176417266 24 Left 1176417252 21:6483856-6483878 CCCCCACAAGGAGCAGAGCAGGG No data
Right 1176417266 21:6483903-6483925 CTAGAGCCAGGAGGTTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176417252 Original CRISPR CCCTGCTCTGCTCCTTGTGG GGG (reversed) Intergenic
No off target data available for this crispr