ID: 1176418289

View in Genome Browser
Species Human (GRCh38)
Location 21:6492847-6492869
Sequence GAGGCTTATCCCTTCTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176418289_1176418296 20 Left 1176418289 21:6492847-6492869 CCTCCCTAGAAGGGATAAGCCTC No data
Right 1176418296 21:6492890-6492912 AGTTCTTGCTGTGTGCGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176418289 Original CRISPR GAGGCTTATCCCTTCTAGGG AGG (reversed) Intergenic