ID: 1176418982

View in Genome Browser
Species Human (GRCh38)
Location 21:6499219-6499241
Sequence CCCGCGGGCGTCGGCAGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 1, 2: 1, 3: 4, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176418982_1176418987 -10 Left 1176418982 21:6499219-6499241 CCGACCCTGCCGACGCCCGCGGG 0: 1
1: 1
2: 1
3: 4
4: 110
Right 1176418987 21:6499232-6499254 CGCCCGCGGGAGACGTCACCCGG 0: 1
1: 1
2: 0
3: 1
4: 40
1176418982_1176418992 22 Left 1176418982 21:6499219-6499241 CCGACCCTGCCGACGCCCGCGGG 0: 1
1: 1
2: 1
3: 4
4: 110
Right 1176418992 21:6499264-6499286 CGCTCTTCCCCGCCCCGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176418982 Original CRISPR CCCGCGGGCGTCGGCAGGGT CGG (reversed) Intergenic
903792609 1:25905619-25905641 CCCGCGCGCGTGGGAAGGGGAGG + Intronic
904993144 1:34610209-34610231 CCAGAGGGTGTGGGCAGGGTAGG - Intergenic
905867133 1:41382452-41382474 CCCGGCGGCGGCGGCAGCGTAGG - Exonic
921632698 1:217454739-217454761 CCCGTGGGGGCCGGGAGGGTGGG - Intronic
1078315415 11:10289698-10289720 CCCGGTGCCCTCGGCAGGGTGGG + Intronic
1083686395 11:64378725-64378747 CCAGCGGGCGACTGCAGGGCAGG - Intergenic
1089397577 11:118145985-118146007 CGCGCGGGCGCAGCCAGGGTGGG + Intronic
1091387735 12:105317-105339 CCCGCTGGCAGGGGCAGGGTGGG + Intronic
1091750507 12:3018954-3018976 CCCAGGGGAGTCGGCAGGGGCGG + Intronic
1101321565 12:103677487-103677509 CCTGCGTGTGTCAGCAGGGTTGG + Exonic
1103122145 12:118389239-118389261 CCCACGGGCTGGGGCAGGGTAGG - Intronic
1103569011 12:121831760-121831782 GCCGCCTGCGTCCGCAGGGTGGG - Exonic
1103967077 12:124646714-124646736 CCCGAGCGCGGGGGCAGGGTGGG + Intergenic
1112290893 13:98143362-98143384 CCCGCGGGCGGCGGCGGCGCGGG - Intronic
1112365446 13:98752251-98752273 CCAGCGGGTGACGGCAGGGGCGG - Intronic
1114558635 14:23576456-23576478 CCTGCGGGCGGCGGAGGGGTGGG + Exonic
1120914778 14:89701613-89701635 CCCGCAGGCGCCGGCGGCGTCGG + Intergenic
1121605673 14:95238133-95238155 GCCGTGGGAGTCGGCAGCGTTGG - Intronic
1125033061 15:35092445-35092467 CCCGCGGGCGTCAGCAGGGGCGG + Intergenic
1125524834 15:40368300-40368322 CCGCCGGGCGGCGGCAGCGTGGG - Exonic
1126592560 15:50354800-50354822 TCCGCGGGGGTCGGCGGGGTCGG - Intronic
1132314487 15:100880020-100880042 CCCGCGGCCGTCGGGTGGGAGGG - Intronic
1132684940 16:1158356-1158378 CCCGGGGGTGACGACAGGGTAGG + Intronic
1132689808 16:1177415-1177437 CTCCGGGGCGACGGCAGGGTGGG - Intronic
1132893133 16:2214353-2214375 GCCGTGGGCGTCGCCAGCGTGGG - Exonic
1137231751 16:46573462-46573484 CCTGGGGGAGTCGGCAGGGCTGG + Intergenic
1142199593 16:88754741-88754763 CCTGCGGGCCCCGGCAGTGTGGG - Intronic
1143198822 17:5097884-5097906 CCCGCGTGCGTGTGCGGGGTGGG + Intergenic
1143697181 17:8629906-8629928 GCCGCGGGCGTGGGGAGGGTCGG - Intronic
1148558377 17:48592119-48592141 CCAGCGGGCGGCGGCAGAGCGGG + Exonic
1148693698 17:49546945-49546967 CCCCCGGGCGCAGGCAGGATCGG - Intergenic
1152078200 17:78171323-78171345 CACTCGGGCCTTGGCAGGGTGGG - Intronic
1157240936 18:46008869-46008891 CCCCAGGGGGTTGGCAGGGTAGG - Intronic
1157867192 18:51197211-51197233 CCCGAGGGCGGCGGCAGAGGCGG + Exonic
1158954143 18:62523557-62523579 CCCGCGGGCGGCGGCGGCGGCGG - Exonic
1160100456 18:75915997-75916019 CCCGCGGCCGTCAGGAGGGGAGG + Intergenic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1160607085 18:80059337-80059359 CCCGAGTGCCTCGGGAGGGTGGG - Intronic
1160909002 19:1466249-1466271 CACGCGGGCGTCGGCGGAGGTGG - Exonic
1163407666 19:17133419-17133441 ACCGGGGGTGGCGGCAGGGTTGG - Intronic
1167145379 19:47678466-47678488 CCCGCGGGCTTGGGCTGGATGGG + Intronic
1167145752 19:47680218-47680240 CCCGCGGGCTTGGGCTGGATGGG - Exonic
1167638594 19:50668394-50668416 CCCGTGGGCTCCGGCTGGGTGGG + Exonic
925731155 2:6920099-6920121 CTGGCAGGCGGCGGCAGGGTTGG + Intronic
927714261 2:25342058-25342080 CCCGCGGGCGGCCGGAGGGAGGG - Intronic
929776789 2:44935151-44935173 CCCGCAGGCGACGGCTGGGGTGG - Intergenic
935396946 2:102619500-102619522 CCCGCGGGCGGGGGCGGGGCGGG - Intergenic
936235773 2:110741298-110741320 TCAGTGGGTGTCGGCAGGGTTGG + Intronic
937988501 2:127649483-127649505 CCAGCGGGCTTCGGCCAGGTGGG - Intronic
943580121 2:189674586-189674608 CGCCCGGGCGGCGGCAGTGTTGG + Intronic
945649215 2:212538400-212538422 CCCGCCGGCGGCTGCAGGTTCGG + Intronic
946185498 2:217978563-217978585 CCCGGGGGCGGGGGCAGGGGCGG - Intronic
1168804355 20:663684-663706 CCGGCGGGGGTCGGCGGGGGTGG + Exonic
1169141919 20:3231293-3231315 CCGGCGGGGGCCGGCAGGGTCGG - Intronic
1172658068 20:36549055-36549077 CCTGCGGGCAGGGGCAGGGTGGG - Exonic
1175805968 20:61829702-61829724 CCCACGGGCGTCGGCACAGAGGG - Intronic
1176418982 21:6499219-6499241 CCCGCGGGCGTCGGCAGGGTCGG - Intergenic
1176555775 21:8253458-8253480 CCCGCGGGCGGCGGCGAGGCGGG - Intergenic
1176574712 21:8436492-8436514 CCCGCGGGCGGCGGCGAGGCGGG - Intergenic
1176611326 21:8987785-8987807 CCCGCGGGCGGCGGCGAGGCGGG - Intergenic
1179411883 21:41168459-41168481 CCCGCGGGGGACGCCAGGGCAGG - Exonic
1179694475 21:43107541-43107563 CCCGAGGGCGTCGGCAGGGTCGG - Exonic
1180064485 21:45405587-45405609 CCTGCGCGCGTGGGCAGGGCCGG - Intronic
1183201448 22:36387865-36387887 CGCTCGGGCGGCGGCCGGGTGGG + Exonic
1183939528 22:41285579-41285601 CCCGCGGGCGTGGGCCTGCTGGG + Intronic
1184222663 22:43110814-43110836 GCAGCGGGCGGCAGCAGGGTCGG - Intronic
1184341901 22:43890891-43890913 CCAGAGAGGGTCGGCAGGGTGGG - Intronic
1184608307 22:45586819-45586841 CCCGAGGGCCCAGGCAGGGTGGG + Intronic
1184762306 22:46551488-46551510 CCCGCTGGCGTTGGCAGGTGGGG + Intergenic
1203252760 22_KI270733v1_random:125543-125565 CCCGCGGGCGGCGGCGAGGCGGG - Intergenic
1203260816 22_KI270733v1_random:170629-170651 CCCGCGGGCGGCGGCGAGGCGGG - Intergenic
949351220 3:3126766-3126788 CCAGCGGGCCTCGGCGGGGCTGG + Intergenic
950569756 3:13792727-13792749 CCCGTGGGGATCGGCAGGGATGG + Intergenic
953326117 3:42013733-42013755 CGCGGGGGCGGCGGCCGGGTGGG - Intergenic
960684762 3:120285285-120285307 CACGCGGGCGGCGCCAGGGAGGG - Intergenic
963511124 3:146250873-146250895 GCCGAGGGCGTCGTCAGGGGAGG - Intronic
971244774 4:24917649-24917671 ACCGTGGGCGTCGGTGGGGTGGG + Intronic
975463997 4:74688576-74688598 CTTGCTGGCATCGGCAGGGTTGG + Intergenic
985572946 5:660046-660068 ACCGCGGACGTCCGCGGGGTGGG - Exonic
992838812 5:80667636-80667658 CATGCTGGCTTCGGCAGGGTGGG + Intronic
997297532 5:132777303-132777325 CCCGCGGGCGGGGGCAGGGGCGG - Exonic
1002057950 5:176609672-176609694 CCAGCGGGCGGCGGCAAGGCCGG + Intronic
1002181226 5:177432119-177432141 CCCGCGGGGCTGGGCAGGGCTGG - Intronic
1002896792 6:1384228-1384250 CCCGCGGGCGCCTCCTGGGTGGG + Intergenic
1013330315 6:109094581-109094603 CCGGCCGGCGCCGGCAGGGAAGG + Exonic
1018962318 6:168457665-168457687 CTCGTGGGCGTGGGGAGGGTGGG - Intronic
1019516439 7:1442257-1442279 TCCTCAGGGGTCGGCAGGGTGGG - Exonic
1020278228 7:6637282-6637304 CCCGCGGGCGCGGGCGGGGCGGG + Intergenic
1027774078 7:82443557-82443579 ACCGCGGGCGTCTGGAGGGCTGG + Exonic
1028712141 7:93921747-93921769 CCCGCGGGGGACGGCTGGGCTGG - Exonic
1030927637 7:115477571-115477593 CCAGCGGGCGTGGACAGGGAAGG + Intergenic
1031401564 7:121330100-121330122 TCCGAGGGGGTCGGCGGGGTAGG - Intronic
1032117000 7:129126300-129126322 CCCTCGGGCCTCGGCAGCGGCGG + Intergenic
1033477198 7:141702228-141702250 CCGGCGGGCGGCGGCGGCGTTGG - Intergenic
1034469769 7:151248953-151248975 CCCGCGGGCCTCGGCGGCTTCGG - Exonic
1035272362 7:157728003-157728025 CCCACAGACGTCTGCAGGGTGGG - Intronic
1035601520 8:899923-899945 CCCGCTGGCCTCGGGAGGGAGGG - Intergenic
1036754886 8:11465595-11465617 CCTGAGGGCGTTGGCAGGATAGG - Intronic
1037273793 8:17156680-17156702 CCCGCGGGCGGCGGCGGAGCTGG + Exonic
1037879306 8:22565384-22565406 CACGCCGGCGACCGCAGGGTCGG + Intronic
1043847267 8:85177450-85177472 CCAGCAGGCGCCGGCAGGGCAGG + Exonic
1049378619 8:142301230-142301252 CCCGCTGGCATGGGCAGGGCAGG - Intronic
1049378641 8:142301292-142301314 CCCGCTGGCATGGGCAGGGCAGG - Intronic
1049378687 8:142301421-142301443 CCCGCTGGCATGGGCAGGGCAGG - Intronic
1049378709 8:142301483-142301505 CCCGCTGGCATGGGCAGGGCAGG - Intronic
1049378734 8:142301550-142301572 CCCGCTGGCATGGGCAGGGCAGG - Intronic
1049426843 8:142541529-142541551 GCCGTGGGCGTCGGGAGCGTTGG + Intronic
1054820448 9:69516207-69516229 CCCGCGGGCGGCGGCGAGGCGGG - Exonic
1062536426 9:137023061-137023083 CCCACGGGAGAGGGCAGGGTCGG + Intronic
1203469163 Un_GL000220v1:108694-108716 CCCGCGGGCGGCGGCGAGGCGGG - Intergenic
1203476984 Un_GL000220v1:152666-152688 CCCGCGGGCGGCGGCGAGGCGGG - Intergenic
1187867866 X:23740474-23740496 CGAGCGGGCGTGGGAAGGGTTGG + Intronic
1189322566 X:40095747-40095769 GCCGCCGGCGTCTGGAGGGTGGG - Intronic
1190679328 X:52811434-52811456 CCAGCGGGCTTCCGGAGGGTCGG + Intergenic
1196762001 X:119208775-119208797 CCCGTGGGCGTGGGCTGGGCAGG - Intergenic
1196925550 X:120630147-120630169 CGCGCAGGCGTCGGAAGGGCCGG + Exonic
1200068808 X:153517893-153517915 CGCGCGGGCGCCGCCGGGGTGGG + Intronic