ID: 1176422631

View in Genome Browser
Species Human (GRCh38)
Location 21:6528195-6528217
Sequence AGCTTTCTGCAGACCATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176422631_1176422634 -2 Left 1176422631 21:6528195-6528217 CCTGCCATGGTCTGCAGAAAGCT No data
Right 1176422634 21:6528216-6528238 CTGTAAACTCTCCCTCCCCAGGG No data
1176422631_1176422640 20 Left 1176422631 21:6528195-6528217 CCTGCCATGGTCTGCAGAAAGCT No data
Right 1176422640 21:6528238-6528260 GAGACAGACGCTCGTCTCCCTGG No data
1176422631_1176422633 -3 Left 1176422631 21:6528195-6528217 CCTGCCATGGTCTGCAGAAAGCT No data
Right 1176422633 21:6528215-6528237 GCTGTAAACTCTCCCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176422631 Original CRISPR AGCTTTCTGCAGACCATGGC AGG (reversed) Intergenic
No off target data available for this crispr