ID: 1176424633

View in Genome Browser
Species Human (GRCh38)
Location 21:6540639-6540661
Sequence CACAGGGACGTGCGCACGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176424633_1176424640 4 Left 1176424633 21:6540639-6540661 CCAGCCGTGCGCACGTCCCTGTG No data
Right 1176424640 21:6540666-6540688 CCGCAAGGAACAGAACGACTTGG No data
1176424633_1176424641 18 Left 1176424633 21:6540639-6540661 CCAGCCGTGCGCACGTCCCTGTG No data
Right 1176424641 21:6540680-6540702 ACGACTTGGTCATCTTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176424633 Original CRISPR CACAGGGACGTGCGCACGGC TGG (reversed) Intergenic
No off target data available for this crispr