ID: 1176424879

View in Genome Browser
Species Human (GRCh38)
Location 21:6542230-6542252
Sequence CCTCCTTTACTCAAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176424879_1176424888 21 Left 1176424879 21:6542230-6542252 CCGTCCACCTTGAGTAAAGGAGG No data
Right 1176424888 21:6542274-6542296 GGCCTTGTTCAAACAGTCAAAGG No data
1176424879_1176424884 -4 Left 1176424879 21:6542230-6542252 CCGTCCACCTTGAGTAAAGGAGG No data
Right 1176424884 21:6542249-6542271 GAGGTGATCCTGAATGACATGGG No data
1176424879_1176424885 -1 Left 1176424879 21:6542230-6542252 CCGTCCACCTTGAGTAAAGGAGG No data
Right 1176424885 21:6542252-6542274 GTGATCCTGAATGACATGGGTGG No data
1176424879_1176424883 -5 Left 1176424879 21:6542230-6542252 CCGTCCACCTTGAGTAAAGGAGG No data
Right 1176424883 21:6542248-6542270 GGAGGTGATCCTGAATGACATGG No data
1176424879_1176424886 0 Left 1176424879 21:6542230-6542252 CCGTCCACCTTGAGTAAAGGAGG No data
Right 1176424886 21:6542253-6542275 TGATCCTGAATGACATGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176424879 Original CRISPR CCTCCTTTACTCAAGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr