ID: 1176428270

View in Genome Browser
Species Human (GRCh38)
Location 21:6561771-6561793
Sequence GGGCAGTGACCTCATTCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 2, 1: 0, 2: 1, 3: 14, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176428266_1176428270 4 Left 1176428266 21:6561744-6561766 CCGCTTCTATAGACAGCATGACA 0: 2
1: 0
2: 0
3: 12
4: 108
Right 1176428270 21:6561771-6561793 GGGCAGTGACCTCATTCCACAGG 0: 2
1: 0
2: 1
3: 14
4: 147
1176428265_1176428270 8 Left 1176428265 21:6561740-6561762 CCGGCCGCTTCTATAGACAGCAT 0: 2
1: 0
2: 0
3: 7
4: 71
Right 1176428270 21:6561771-6561793 GGGCAGTGACCTCATTCCACAGG 0: 2
1: 0
2: 1
3: 14
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176428270 Original CRISPR GGGCAGTGACCTCATTCCAC AGG Intergenic
900130543 1:1085392-1085414 GGGCACTGACCCCTTCCCACTGG - Intronic
900602817 1:3510278-3510300 GGCCAGTGACCTCAGGCCAGAGG + Intronic
900899071 1:5504564-5504586 GGGGAGTGATCTCATCCCCCTGG + Intergenic
902938112 1:19779378-19779400 GGTCATTGTCCTCATTCCCCTGG + Intronic
903177115 1:21587793-21587815 GGGCAAAGGCCTCTTTCCACAGG + Intergenic
906327309 1:44855146-44855168 GGTCAGTGCCCTCCTGCCACAGG - Intronic
906903694 1:49865345-49865367 GGGCACTGACCTGATGCCAGAGG - Intronic
907745207 1:57206449-57206471 AGGCAGTGACCTAACACCACTGG + Intronic
910277470 1:85464733-85464755 CGGCAGTTACCTCCTTCCTCCGG + Exonic
916811969 1:168313600-168313622 GAGAATTGACTTCATTCCACTGG - Exonic
918812828 1:189141845-189141867 TGGCAGTGGCATGATTCCACTGG - Intergenic
920049892 1:203157539-203157561 GGGCAGTGGCCTCACTCCCATGG + Intronic
921048613 1:211494850-211494872 GGGCAGTAATCTCATTCCTGAGG - Intergenic
923190211 1:231613131-231613153 GGGCAGTGAAATCATTCAGCAGG - Intronic
924072662 1:240297967-240297989 GGGCACTGATCTCATTCAAGAGG + Intronic
924235058 1:241993644-241993666 GGGCAGTGCCTTCATCCCCCTGG + Intergenic
924571601 1:245241845-245241867 GGGGACTGAGCTCATACCACAGG - Intronic
1064123480 10:12638994-12639016 GGGCGGGAACCTCATTCCTCTGG + Intronic
1065247868 10:23777157-23777179 GAGCACTGACCTCATTTCTCTGG - Intronic
1067701686 10:48577740-48577762 GGGCAGTCACCTCTTGGCACTGG + Intronic
1067744713 10:48927031-48927053 AGGCAGTGACCTCTTTGCCCTGG + Intronic
1074031884 10:109697161-109697183 GGGCAGTGACCCCAACCTACTGG + Intergenic
1074206700 10:111288985-111289007 GGACAGAGCCCTCAGTCCACTGG + Intergenic
1079006360 11:16794079-16794101 GGGCAGTGAGTTCAGTCCAGTGG - Intronic
1084881294 11:72173309-72173331 GGCCAGGGCCCTCATGCCACAGG + Intergenic
1089495207 11:118904736-118904758 GGGCAGTGACCACCTTCCCATGG + Intronic
1090908179 11:131095621-131095643 GACCAATGACCTCATTCCCCTGG + Intergenic
1091356487 11:134941643-134941665 GGGCAGTGGCATCATTGCCCAGG - Intergenic
1093800420 12:23365396-23365418 GAGCACTGACCTCATTCCTTTGG - Intergenic
1094681965 12:32675013-32675035 GCACACTCACCTCATTCCACAGG + Intergenic
1095685852 12:45032400-45032422 GGTCAGTGTCCTCAGTCCACTGG + Intronic
1097324145 12:58256804-58256826 GGGAATTAACCTCACTCCACTGG - Intergenic
1105966846 13:25392704-25392726 GAGCAGTGACCCCATTTCTCTGG + Intronic
1111305727 13:86410101-86410123 GGGCACTGACCTGATGCCATAGG - Intergenic
1111812854 13:93113597-93113619 TGGCAGTGAGCTCCTTGCACAGG - Intergenic
1112434515 13:99382508-99382530 GGGCAGTGGCCTCACTGCCCTGG + Intronic
1113155406 13:107314678-107314700 GGCCACTGAGCTCATCCCACAGG + Intronic
1114572190 14:23679383-23679405 GGGCAGTAATCTCATTCCTGAGG - Intergenic
1117106483 14:52402328-52402350 GGGCAGTGACTTCATTTTACTGG - Intergenic
1119602750 14:75988068-75988090 GGGCAGATACCTCATGCCACAGG - Intronic
1120598955 14:86476559-86476581 CAGCAGTGACCTAATCCCACTGG + Intergenic
1125646136 15:41274333-41274355 GGGCAGATAGCTCATGCCACTGG + Intronic
1129834490 15:78693505-78693527 GGGGAGTGAGCTCATCCCAGAGG - Intronic
1129855787 15:78824057-78824079 GAGCACTGACCTCATGCCACAGG + Intronic
1132549309 16:547789-547811 GGGCAGTGACATCATTGACCTGG + Exonic
1133580771 16:7142367-7142389 GGACATGGACCTCATTTCACGGG - Intronic
1134335212 16:13292839-13292861 AAGCAGTGCCCTCATTCAACTGG - Intergenic
1135757483 16:25109938-25109960 TAGCAGTGTCCACATTCCACGGG - Intergenic
1137694646 16:50453561-50453583 GGGCAGGGTCCTAGTTCCACTGG + Intergenic
1140551694 16:75873002-75873024 GGGCACTGATCTCATTCAAGAGG + Intergenic
1140655091 16:77132207-77132229 GCACAGTGACCTCTTTCCTCTGG + Intergenic
1142521964 17:511181-511203 TGCCAGAGACCACATTCCACAGG - Exonic
1143037056 17:4005368-4005390 GGGCAATGGCCTCAGTCCTCAGG + Exonic
1143063488 17:4223371-4223393 GGCCAGGTAGCTCATTCCACAGG - Intronic
1144951573 17:18997211-18997233 GGGTAGTGCCTTCATGCCACTGG - Intronic
1146725579 17:35153031-35153053 GGACAGTGACATCATTCCGAGGG + Intronic
1151759238 17:76091146-76091168 GGGCTCTAACCTCATTCCTCTGG - Exonic
1151965783 17:77430496-77430518 GGGAAGTGACCTCATAGCAAGGG + Intronic
1152661860 17:81546050-81546072 GAGCAGTGGCCTCCTTCCTCTGG - Intronic
1154498162 18:14977661-14977683 GGGCAGTGGCATCATTGCCCAGG + Intergenic
1155619924 18:27767150-27767172 GGGCACTAATCTCATTCAACAGG + Intergenic
1158507487 18:58059516-58059538 GGGCAGTGTCCTCCTTGCCCAGG + Intronic
1158676910 18:59528858-59528880 GGGCACTGACCTGATGCCAGTGG + Intronic
1160362641 18:78297018-78297040 GGCCACTGACCCCATTCCCCCGG - Intergenic
1161070301 19:2256492-2256514 CGGCTGTGACCTCACTCCAGCGG - Intronic
1165114877 19:33522765-33522787 GGGCAGTGAGGTCACTCCTCAGG - Intergenic
1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG + Intronic
1165818393 19:38658003-38658025 GGGGAGTGCCCTCATACCAGAGG + Intronic
927809769 2:26174363-26174385 GGGCAGCGACCTCCATTCACAGG - Intronic
928081984 2:28319896-28319918 GGGAAGTGACCTCACTCCCGAGG + Intronic
931689697 2:64824723-64824745 GGGCACTGACCCCATTTCTCTGG + Intergenic
932144959 2:69308401-69308423 GGGCTGGGACCACATACCACAGG - Intergenic
932448649 2:71795821-71795843 TGGCAGTGACTTCCTGCCACAGG - Intergenic
932576367 2:72964458-72964480 GGGCAGTGTCCTCATTTTCCAGG + Intronic
934574197 2:95390184-95390206 GGGAAGTGACCTCAGGGCACAGG + Intergenic
937012701 2:118576068-118576090 GGGCAGAGACCTCATCCCGGAGG + Intergenic
937583745 2:123521341-123521363 GGGCAGTGAGATTATTCCATAGG - Intergenic
938118985 2:128620673-128620695 GGGCACTGATCTCATTCCAAAGG - Intergenic
938369724 2:130761646-130761668 GGGCAGTGGCCTCCTTCATCAGG - Intronic
940337315 2:152543083-152543105 GGGCAGTGAGTGCATTCCAGAGG + Intronic
945839705 2:214872899-214872921 AGGCAGTGACATCATTCCTCTGG + Intergenic
946102476 2:217337949-217337971 GGGAAGTGACCTCATACCCTGGG - Intronic
948271950 2:236681118-236681140 TGCCAGTGAGGTCATTCCACAGG + Intergenic
1173329884 20:42066970-42066992 TGGCAGAGACCTGATTTCACAGG + Intergenic
1173375242 20:42477046-42477068 GTGCAGCGACCTCAGTCCTCAGG + Intronic
1176428270 21:6561771-6561793 GGGCAGTGACCTCATTCCACAGG + Intergenic
1179703760 21:43170087-43170109 GGGCAGTGACCTCATTCCACAGG + Intronic
1180056667 21:45362464-45362486 TGCCAGTGAGCCCATTCCACAGG + Intergenic
1180720415 22:17903742-17903764 TGGCAGTGACCACATTCCACTGG - Intronic
1181791078 22:25267026-25267048 AGGCAGTGACCTGCTGCCACTGG + Intergenic
1181826890 22:25524056-25524078 AGGCAGTGACCTGCTGCCACTGG + Intergenic
1183351171 22:37335400-37335422 GGGCGGCGACCTCAGTCAACCGG - Intergenic
1184950986 22:47842473-47842495 GGGCAGGGAGCTCATGGCACTGG - Intergenic
1185109491 22:48893164-48893186 GGTCAGTGCCCTCATCCCTCTGG - Intergenic
949465985 3:4344275-4344297 GGGCACTGACCTGATGCCAATGG - Intronic
954145089 3:48630538-48630560 GGGGAGAGACCTCCTTCCCCAGG + Intronic
954672301 3:52297619-52297641 GGGCAGTGGCCTCATAGGACTGG - Intergenic
955024682 3:55155983-55156005 TGGCAGTGCCCTCATTCCAGCGG - Intergenic
956645103 3:71447473-71447495 GGTCAGTGGCCTAGTTCCACAGG + Intronic
962295052 3:134175974-134175996 GGCCAGGTAGCTCATTCCACAGG + Exonic
962631757 3:137283442-137283464 GGGCTGTTACCTTATTCCACTGG + Intergenic
964336950 3:155665032-155665054 GGGCAATGCCCAAATTCCACTGG - Intronic
964515907 3:157507357-157507379 GTGTAGTGACCTCACTACACAGG - Intronic
966071557 3:175885142-175885164 GGGCACTGACCTGATGCCAGCGG + Intergenic
969595256 4:8145083-8145105 GAGCAGTGACATCACCCCACAGG + Intronic
969897140 4:10315994-10316016 TGGGAGAGACCACATTCCACTGG - Intergenic
972508081 4:39740217-39740239 GGGCAGTGACATTATTCTAGAGG + Intronic
972934876 4:44121712-44121734 TGGCAGTGACATGATTCAACTGG - Intergenic
973980700 4:56306085-56306107 GGCCAGTCACCTCTCTCCACTGG + Intronic
976154132 4:82124633-82124655 GGTTAGAGACTTCATTCCACAGG - Intergenic
982926222 4:161340001-161340023 GGGCACTGACCCCATTTTACTGG - Intergenic
983934037 4:173486819-173486841 TGGCAGTGACCACATCCCTCTGG + Intergenic
985484205 5:139809-139831 GGTCAGTGACGTCGCTCCACGGG - Intergenic
986593322 5:9394174-9394196 TGTGGGTGACCTCATTCCACTGG - Intronic
988922409 5:35955688-35955710 CGGCTGTGACCTGATTCAACCGG + Exonic
991220258 5:64206228-64206250 GGGCAGTTACCAAATTCTACTGG + Intronic
995409396 5:111837861-111837883 GGGTCGTCACCTCATTCCAGTGG + Intronic
995634199 5:114166826-114166848 GGGCACTGATCTCATTCATCAGG - Intergenic
996116705 5:119628248-119628270 GGGCAGTGGCCCCAGTCCAGTGG - Intronic
999081648 5:148849916-148849938 GGGCAGAGACAGCATACCACTGG - Intergenic
1003558103 6:7158472-7158494 GGGCAGGGGCCTCATTACAGAGG - Intronic
1004752773 6:18580907-18580929 GGGCAGTGAGCTCATTCTGAGGG + Intergenic
1008671012 6:53768833-53768855 GCAAAGTGAACTCATTCCACTGG - Intergenic
1013326407 6:109048578-109048600 GAGGAGTGAACTCCTTCCACAGG + Intronic
1016507254 6:144796266-144796288 GGGCACTAACCTCATTCAAGAGG + Intronic
1018096347 6:160390352-160390374 AGGCACTGGCCTCATTCCCCAGG + Intronic
1020430089 7:8109841-8109863 GGGGAGTGGCCTCATGGCACAGG + Intergenic
1022766639 7:33420004-33420026 GTTCAGTTACCTCATTTCACAGG + Intronic
1023117324 7:36875131-36875153 AGTCAGAAACCTCATTCCACTGG - Intronic
1024859699 7:53824007-53824029 GGGCACTGACCTGTTGCCACTGG - Intergenic
1026537324 7:71250381-71250403 AGGCAGTGACCTAAATCCCCTGG - Intronic
1026650622 7:72213020-72213042 GGGCTCTGCCCTCATTTCACAGG + Intronic
1026872473 7:73861364-73861386 AGGCAGCCACCTCGTTCCACTGG - Intronic
1029462621 7:100705358-100705380 GGGCAGAGCCCCCACTCCACTGG + Intergenic
1034561005 7:151879000-151879022 GGCGAGGGCCCTCATTCCACTGG + Intergenic
1035562889 8:619783-619805 TGGAATTGAACTCATTCCACAGG + Intronic
1036205277 8:6800963-6800985 GGTCAGTCCCATCATTCCACAGG + Intergenic
1036616373 8:10390728-10390750 GGGCACTGACTCCATTCCAAAGG + Intronic
1036688846 8:10928650-10928672 GGCAAGTGATCTCATCCCACAGG + Intronic
1038280708 8:26161615-26161637 GGGCAGTGACCACAAGTCACAGG + Intergenic
1039734500 8:40316117-40316139 GGCCAGAGACTTCCTTCCACAGG - Intergenic
1039765134 8:40620371-40620393 GGCTAGTGACCTCAGGCCACAGG + Intronic
1041945226 8:63433508-63433530 GGCAAGTGACCTGATTCCCCAGG + Intergenic
1042893778 8:73643150-73643172 TGGCAGTAACCTCTATCCACTGG + Intronic
1048563477 8:135568053-135568075 AGGCAGTAACCGCATTACACAGG - Intronic
1049383807 8:142330954-142330976 GGGCAGTGACCTCCTTGGAGCGG - Exonic
1055381261 9:75709263-75709285 GAACAGTGACCTCATTCCTTTGG + Intergenic
1056222946 9:84467986-84468008 GGGCATTGATCTCATTCCTGGGG - Intergenic
1057241591 9:93416560-93416582 GGGCAGTGACCTTATGCCAGTGG + Intergenic
1057762816 9:97890344-97890366 GGTCAGTGACAACAGTCCACAGG - Intergenic
1060504603 9:124188434-124188456 GGGCTGTGGCCTCATTCCTCAGG + Intergenic
1061160139 9:128889055-128889077 GGCCAGAGACCTCATCCCTCTGG - Intronic
1062197867 9:135284676-135284698 GGACACTGTCCTCATTCCACAGG - Intergenic
1062371238 9:136239960-136239982 GGGCACTGGCCTCATTCAACGGG + Intronic
1062536504 9:137023420-137023442 GGGCAGTGACCTCTGACCTCTGG + Intronic
1186096978 X:6112774-6112796 ACGTAGTGACCTCTTTCCACAGG + Intronic
1189801828 X:44698693-44698715 GGTCAGTGACCTCTTTCTCCTGG + Intergenic
1192233777 X:69283651-69283673 GGGCAGGGACCAAATGCCACAGG + Intergenic
1192548112 X:72030031-72030053 GGGCAGAAACCTCATTCCCTTGG - Intergenic
1193334120 X:80267237-80267259 GGATAGTGACATCATCCCACTGG - Intergenic
1197423971 X:126272744-126272766 GGGCAGTGACCTAATGCCAGTGG + Intergenic
1198332440 X:135634136-135634158 GGGCAGGGACATTATACCACAGG + Intergenic
1199540049 X:148948683-148948705 AAACAGTGACCTCATTCCACAGG - Intronic
1199693797 X:150329122-150329144 GGCCAGTCACCTGATTCCAGGGG + Intergenic