ID: 1176428711

View in Genome Browser
Species Human (GRCh38)
Location 21:6563628-6563650
Sequence AGCCTGCGGGGGCTCTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176428711_1176428718 -1 Left 1176428711 21:6563628-6563650 CCCTGTGAGAGCCCCCGCAGGCT No data
Right 1176428718 21:6563650-6563672 TGGCCCCCTTCTGCAGTCAGTGG No data
1176428711_1176428729 24 Left 1176428711 21:6563628-6563650 CCCTGTGAGAGCCCCCGCAGGCT No data
Right 1176428729 21:6563675-6563697 CTGGGGCAGCTTCTCTGGCATGG No data
1176428711_1176428728 19 Left 1176428711 21:6563628-6563650 CCCTGTGAGAGCCCCCGCAGGCT No data
Right 1176428728 21:6563670-6563692 TGGGGCTGGGGCAGCTTCTCTGG No data
1176428711_1176428726 6 Left 1176428711 21:6563628-6563650 CCCTGTGAGAGCCCCCGCAGGCT No data
Right 1176428726 21:6563657-6563679 CTTCTGCAGTCAGTGGGGCTGGG No data
1176428711_1176428719 0 Left 1176428711 21:6563628-6563650 CCCTGTGAGAGCCCCCGCAGGCT No data
Right 1176428719 21:6563651-6563673 GGCCCCCTTCTGCAGTCAGTGGG No data
1176428711_1176428720 1 Left 1176428711 21:6563628-6563650 CCCTGTGAGAGCCCCCGCAGGCT No data
Right 1176428720 21:6563652-6563674 GCCCCCTTCTGCAGTCAGTGGGG No data
1176428711_1176428725 5 Left 1176428711 21:6563628-6563650 CCCTGTGAGAGCCCCCGCAGGCT No data
Right 1176428725 21:6563656-6563678 CCTTCTGCAGTCAGTGGGGCTGG No data
1176428711_1176428727 7 Left 1176428711 21:6563628-6563650 CCCTGTGAGAGCCCCCGCAGGCT No data
Right 1176428727 21:6563658-6563680 TTCTGCAGTCAGTGGGGCTGGGG No data
1176428711_1176428731 26 Left 1176428711 21:6563628-6563650 CCCTGTGAGAGCCCCCGCAGGCT No data
Right 1176428731 21:6563677-6563699 GGGGCAGCTTCTCTGGCATGGGG No data
1176428711_1176428730 25 Left 1176428711 21:6563628-6563650 CCCTGTGAGAGCCCCCGCAGGCT No data
Right 1176428730 21:6563676-6563698 TGGGGCAGCTTCTCTGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176428711 Original CRISPR AGCCTGCGGGGGCTCTCACA GGG (reversed) Intergenic
No off target data available for this crispr