ID: 1176430369

View in Genome Browser
Species Human (GRCh38)
Location 21:6571644-6571666
Sequence TGTGACAAACGACCACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176430365_1176430369 10 Left 1176430365 21:6571611-6571633 CCAGCAGTGCTGTGGGGAATTTC No data
Right 1176430369 21:6571644-6571666 TGTGACAAACGACCACAAGCTGG No data
1176430361_1176430369 21 Left 1176430361 21:6571600-6571622 CCAGCTGGAATCCAGCAGTGCTG No data
Right 1176430369 21:6571644-6571666 TGTGACAAACGACCACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176430369 Original CRISPR TGTGACAAACGACCACAAGC TGG Intergenic
No off target data available for this crispr